Incidental Mutation 'R1785:Synj1'
Institutional Source Beutler Lab
Gene Symbol Synj1
Ensembl Gene ENSMUSG00000022973
Gene Namesynaptojanin 1
MMRRC Submission 039816-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1785 (G1)
Quality Score225
Status Not validated
Chromosomal Location90936092-91011308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 90964517 bp
Amino Acid Change Alanine to Aspartic acid at position 687 (A687D)
Ref Sequence ENSEMBL: ENSMUSP00000113308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121759] [ENSMUST00000130813] [ENSMUST00000170853] [ENSMUST00000231472]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118246
Predicted Effect unknown
Transcript: ENSMUST00000118390
AA Change: A661D
SMART Domains Protein: ENSMUSP00000113518
Gene: ENSMUSG00000022973
AA Change: A661D

low complexity region 1 15 N/A INTRINSIC
Pfam:Syja_N 75 356 3.1e-71 PFAM
IPPc 546 889 6.37e-177 SMART
DUF1866 882 1024 1.24e-80 SMART
low complexity region 1040 1069 N/A INTRINSIC
low complexity region 1117 1151 N/A INTRINSIC
low complexity region 1155 1166 N/A INTRINSIC
low complexity region 1189 1208 N/A INTRINSIC
low complexity region 1289 1322 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121759
AA Change: A687D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113308
Gene: ENSMUSG00000022973
AA Change: A687D

low complexity region 9 40 N/A INTRINSIC
Pfam:Syja_N 100 381 4.2e-71 PFAM
IPPc 571 914 6.37e-177 SMART
DUF1866 907 1049 1.24e-80 SMART
low complexity region 1065 1094 N/A INTRINSIC
low complexity region 1142 1176 N/A INTRINSIC
low complexity region 1180 1191 N/A INTRINSIC
low complexity region 1214 1233 N/A INTRINSIC
low complexity region 1314 1343 N/A INTRINSIC
Blast:IPPc 1344 1428 1e-17 BLAST
low complexity region 1564 1596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130813
AA Change: A642D

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119712
Gene: ENSMUSG00000022973
AA Change: A642D

Pfam:Syja_N 59 346 1.4e-86 PFAM
low complexity region 441 459 N/A INTRINSIC
IPPc 526 693 1.8e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170853
AA Change: A647D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128997
Gene: ENSMUSG00000022973
AA Change: A647D

Pfam:Syja_N 59 346 1.7e-85 PFAM
IPPc 531 874 6.37e-177 SMART
DUF1866 867 1009 1.24e-80 SMART
low complexity region 1025 1054 N/A INTRINSIC
low complexity region 1102 1136 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
low complexity region 1174 1193 N/A INTRINSIC
low complexity region 1274 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231472
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoinositide phosphatase that regulates levels of membrane phosphatidylinositol-4,5-bisphosphate. As such, expression of this enzyme may affect synaptic transmission and membrane trafficking. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit neurological defects associated with impaired phosphoinositide metabolism and accumulation of clathrin-coated vesicles at nerve endings. Mutants show impaired suckling and most die within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 243 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
Abcc4 G A 14: 118,553,349 R749C probably damaging Het
Acot11 T C 4: 106,762,035 E201G probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aldh4a1 T C 4: 139,644,128 V451A probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Arhgap23 A G 11: 97,451,561 D223G possibly damaging Het
Asb6 G A 2: 30,827,076 R46W probably damaging Het
Aspm A G 1: 139,473,574 I1111V probably benign Het
C4bp C G 1: 130,642,988 V284L probably benign Het
Cacna1s T C 1: 136,118,716 F1761S probably benign Het
Cad T A 5: 31,058,072 F76I probably damaging Het
Camsap2 C T 1: 136,281,315 R802Q probably benign Het
Capn11 A G 17: 45,638,697 S448P probably benign Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cbx5 G A 15: 103,213,124 R29C probably null Het
Ccdc93 C T 1: 121,456,126 P192L probably benign Het
Ccdc93 T C 1: 121,461,939 V237A probably benign Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cd55 C A 1: 130,459,633 A143S probably benign Het
Cdh19 C A 1: 110,893,384 E541D probably damaging Het
Cdh7 C G 1: 110,065,735 L307V possibly damaging Het
Cfh T C 1: 140,136,788 K374R probably benign Het
Cfh C T 1: 140,147,697 V268I possibly damaging Het
Cfhr2 A G 1: 139,813,442 M265T probably benign Het
Cfhr2 A C 1: 139,813,459 N259K probably benign Het
Chil1 C T 1: 134,188,529 A250V probably damaging Het
Cntnap5a C A 1: 116,455,004 L1001I probably benign Het
Cntnap5a T C 1: 116,455,101 L1033S probably benign Het
Cntnap5a C T 1: 116,455,143 T1047I probably benign Het
Cntnap5c A G 17: 58,162,291 I623V probably benign Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Crb1 T C 1: 139,234,779 M1214V probably benign Het
Crb1 A T 1: 139,237,622 H921Q probably benign Het
Crb1 G A 1: 139,241,138 P881S probably damaging Het
Crb1 C T 1: 139,242,995 G825R probably damaging Het
Crb1 C T 1: 139,243,417 R684H probably benign Het
Crocc T C 4: 141,021,802 D1564G probably damaging Het
Csf1r A T 18: 61,129,077 M802L probably damaging Het
Cxcr4 C T 1: 128,589,277 V216I probably benign Het
Cyb5r1 C T 1: 134,407,667 R147W probably damaging Het
Daxx T C 17: 33,911,842 I277T probably damaging Het
Dctn4 T C 18: 60,546,335 probably null Het
Ddx59 T C 1: 136,417,053 V154A probably benign Het
Dnah5 A G 15: 28,313,786 Q1916R probably damaging Het
Dnah8 T C 17: 30,722,937 V1719A probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dsel G C 1: 111,859,994 T937S probably benign Het
Dstyk C T 1: 132,456,984 L739F probably damaging Het
En1 A G 1: 120,603,621 S197G unknown Het
Enah A T 1: 181,956,429 M105K unknown Het
Epm2a A G 10: 11,343,682 E71G probably benign Het
Etnk2 A G 1: 133,363,923 S54G probably benign Het
Etnk2 C A 1: 133,365,587 D89E probably benign Het
Etnk2 G T 1: 133,365,765 G149W probably damaging Het
Etnk2 C T 1: 133,365,816 R166* probably null Het
Etnk2 G A 1: 133,365,817 R166Q probably benign Het
Etnk2 T A 1: 133,376,915 V292E probably benign Het
Eya1 A G 1: 14,170,974 V573A probably benign Het
Faim2 A G 15: 99,512,542 L235P probably damaging Het
Fam221b T A 4: 43,665,537 H307L probably damaging Het
Fam72a T C 1: 131,530,668 I56T probably benign Het
Fam72a C T 1: 131,538,895 T139M probably benign Het
Fbxw10 T A 11: 62,859,857 I422N probably damaging Het
Fcamr A G 1: 130,804,569 R98G probably benign Het
Fcamr A C 1: 130,804,627 N117T probably benign Het
Fcamr A G 1: 130,811,580 I206V probably benign Het
Fcamr G A 1: 130,812,629 G262S probably benign Het
Fcamr A G 1: 130,812,692 I283V probably benign Het
Fcamr T C 1: 130,812,738 V298A probably benign Het
Fcamr A G 1: 130,812,809 M322V probably benign Het
Fcamr C T 1: 130,812,816 P324L probably benign Het
Fcamr A G 1: 130,814,597 N574D probably benign Het
Fcmr A G 1: 130,875,974 T172A probably benign Het
Fcmr T C 1: 130,878,269 S321P probably benign Het
Foxn4 C T 5: 114,263,132 D37N probably damaging Het
Gabarap C T 11: 69,991,689 probably benign Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gli2 C T 1: 118,868,087 A113T possibly damaging Het
Gli2 G T 1: 119,002,044 H44Q probably benign Het
Glrx2 C T 1: 143,739,740 A27V possibly damaging Het
Gm10563 C T 4: 155,635,880 probably benign Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm8374 T C 14: 7,364,194 T49A probably damaging Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gper1 C T 5: 139,426,722 P274L probably damaging Het
Gpr132 A G 12: 112,852,403 S268P probably damaging Het
Gpr25 G A 1: 136,260,710 P55L probably benign Het
Grm7 G C 6: 111,358,295 D556H probably damaging Het
H2-K1 C A 17: 33,997,348 E275* probably null Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Igfn1 G A 1: 135,959,928 P2466L probably damaging Het
Igfn1 G A 1: 135,968,199 A1543V probably benign Het
Igfn1 T C 1: 135,970,411 S806G probably benign Het
Igfn1 C T 1: 135,972,127 R482Q probably benign Het
Igfn1 C T 1: 135,979,915 A231T probably benign Het
Igfn1 G A 1: 135,982,475 R124W probably benign Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Igfn1 T C 1: 135,998,683 I10V unknown Het
Ikbke C A 1: 131,265,937 A459S probably benign Het
Ikbke T C 1: 131,269,823 S447G probably benign Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 TCC TCCGCC 1: 135,386,281 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcnt2 G A 1: 140,354,547 S90N probably benign Het
Kif14 A G 1: 136,468,279 N108D probably benign Het
Kif14 A G 1: 136,468,975 K340E probably damaging Het
Kif14 G A 1: 136,478,365 A556T probably benign Het
Kif14 A G 1: 136,490,332 S868G probably benign Het
Kif14 C T 1: 136,503,431 L1189F probably benign Het
Kif14 T C 1: 136,515,961 F1291L probably benign Het
Kif14 T C 1: 136,525,783 V1433A probably benign Het
Kmt2a G A 9: 44,819,675 probably benign Het
Krtap16-1 A T 11: 99,985,776 C267* probably null Het
Lad1 C T 1: 135,827,381 P132S possibly damaging Het
Lad1 C T 1: 135,828,023 R346C probably damaging Het
Lax1 T C 1: 133,679,978 R342G probably benign Het
Lax1 T C 1: 133,680,569 N145D probably benign Het
Lax1 G A 1: 133,683,634 P67S probably damaging Het
Lgr6 C T 1: 134,987,088 V641I probably benign Het
Lgr6 A T 1: 134,988,009 S334T probably benign Het
Lgr6 G T 1: 134,990,635 H263N probably benign Het
Lgr6 C T 1: 135,003,476 S3N probably benign Het
Lhx6 G T 2: 36,087,458 C327* probably null Het
Lifr A G 15: 7,181,856 D625G possibly damaging Het
Lman1 A T 18: 65,991,582 M362K probably damaging Het
Lmod1 C T 1: 135,364,073 T222I probably benign Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lpin3 T A 2: 160,896,809 L227* probably null Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mki67 T A 7: 135,704,241 probably null Het
Mnx1 T A 5: 29,474,189 S299C unknown Het
Mov10 A T 3: 104,818,116 I59N possibly damaging Het
Mpo A G 11: 87,797,361 D282G possibly damaging Het
Mroh3 G C 1: 136,192,144 Q440E possibly damaging Het
Mybph C T 1: 134,197,480 R249C probably benign Het
Myo7b T C 18: 31,994,897 I581V probably benign Het
Nav1 A T 1: 135,584,727 D198E possibly damaging Het
Ncdn T A 4: 126,745,273 probably null Het
Ndufa4 A T 6: 11,900,575 V37E probably benign Het
Nop9 T C 14: 55,751,142 L347P probably damaging Het
Nr5a2 C A 1: 136,952,125 R35L probably benign Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr195 A G 16: 59,149,297 Y149C probably damaging Het
Olfr279 A T 15: 98,497,835 D121V probably damaging Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr372 A G 8: 72,058,436 Y252C probably damaging Het
Optc A T 1: 133,903,796 probably null Het
Optc C G 1: 133,905,170 S64T probably benign Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pbx1 T G 1: 168,431,378 I43L probably benign Het
Phf2 T C 13: 48,817,567 D543G unknown Het
Pigr C T 1: 130,844,522 A159V possibly damaging Het
Pik3c2b C T 1: 133,066,627 P110S probably benign Het
Pkd1 T C 17: 24,591,099 V3558A probably benign Het
Pla2g6 T C 15: 79,306,345 Y339C probably benign Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Plekha6 C G 1: 133,287,846 T792S probably benign Het
Ppard T G 17: 28,298,481 probably null Het
Ppfia4 G A 1: 134,299,321 P1159S probably benign Het
Ppm1f A G 16: 16,910,970 T79A probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptgdr A T 14: 44,858,579 Y225* probably null Het
Ptpn22 A G 3: 103,874,052 I90V probably damaging Het
Ptpn7 A G 1: 135,134,475 Q53R probably benign Het
Ptprc T G 1: 138,099,676 N478T probably benign Het
Ptprc A G 1: 138,107,823 S405P probably benign Het
Ptprc C A 1: 138,107,824 E402D probably benign Het
Ptprc A G 1: 138,107,837 V400A probably benign Het
Ptprc T C 1: 138,112,254 K212E possibly damaging Het
Pus7l T C 15: 94,540,637 N109S probably benign Het
Rab29 A G 1: 131,872,110 Q141R probably benign Het
Ren1 C G 1: 133,350,778 probably null Het
Ren1 T A 1: 133,354,206 W22R probably damaging Het
Ren1 C T 1: 133,354,237 T32I probably benign Het
Ren1 A T 1: 133,359,079 E315D probably benign Het
Ren1 A T 1: 133,359,983 N352Y probably benign Het
Ren1 C G 1: 133,360,007 L360V probably benign Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Ripk4 A C 16: 97,750,131 V149G probably damaging Het
Rnpep C T 1: 135,263,096 A571T possibly damaging Het
Rnpep G C 1: 135,283,977 A11G probably benign Het
Rora G A 9: 69,376,837 A396T probably benign Het
Scap C T 9: 110,374,055 L266F probably damaging Het
Scn5a A T 9: 119,521,129 I893N probably damaging Het
Sctr T C 1: 120,031,656 F110L probably benign Het
Sctr G T 1: 120,063,246 E453D probably benign Het
Sctr G A 1: 120,063,257 S440N possibly damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Serpinb10 C T 1: 107,538,473 S63F probably damaging Het
Serpinb2 G A 1: 107,515,635 A55T probably damaging Het
Serpinb2 C A 1: 107,523,834 A239E probably benign Het
Serpinb2 C T 1: 107,523,890 H258Y probably benign Het
Serpinb2 C T 1: 107,523,894 T259I probably benign Het
Serpinb2 A C 1: 107,524,543 S284R probably benign Het
Serpinb8 A G 1: 107,597,527 S20G probably benign Het
Serpinb8 G A 1: 107,598,954 A75T probably benign Het
Serpinb8 A C 1: 107,607,004 L268F probably benign Het
Slc26a9 C T 1: 131,763,870 A617V probably benign Het
Slc26a9 C A 1: 131,766,012 R747S probably benign Het
Slc9a4 T G 1: 40,607,741 probably null Het
Slc9a9 A T 9: 95,019,193 N393I possibly damaging Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Steap3 T C 1: 120,227,750 N493S probably benign Het
Steap3 G A 1: 120,234,378 A350V probably benign Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tbx1 A C 16: 18,585,129 F138V probably damaging Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Thsd7b C T 1: 129,628,891 T328I probably damaging Het
Thsd7b T A 1: 129,667,937 F498Y probably benign Het
Thsd7b G C 1: 129,678,183 A554P probably benign Het
Thsd7b A C 1: 130,116,631 Q1116P probably benign Het
Tnnt2 C T 1: 135,845,506 probably benign Het
Trappc8 A G 18: 20,834,940 probably null Het
Trim33 AGACTG A 3: 103,329,220 probably null Het
Trim41 C A 11: 48,807,592 G516W probably damaging Het
Trove2 C T 1: 143,760,014 V465I probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ttn A C 2: 76,885,926 probably null Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ube2t C T 1: 134,972,167 A149V probably benign Het
Ubr4 T A 4: 139,423,945 M1897K probably damaging Het
Uggt2 A G 14: 119,061,376 L391P probably damaging Het
Vmn2r55 A T 7: 12,668,184 D392E probably damaging Het
Vps13b A G 15: 35,879,791 Y3004C probably damaging Het
Vps26a A T 10: 62,468,397 D180E probably benign Het
Wisp1 G A 15: 66,906,489 C53Y probably damaging Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Zbtb46 C T 2: 181,391,431 C479Y probably damaging Het
Zc3h11a G A 1: 133,622,154 P695S probably benign Het
Zc3h11a C T 1: 133,624,621 V583I probably benign Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Zp3r A G 1: 130,596,814 L164P probably benign Het
Zp3r C A 1: 130,619,414 E8D possibly damaging Het
Other mutations in Synj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Synj1 APN 16 90951976 missense probably damaging 1.00
IGL01468:Synj1 APN 16 91010172 splice site probably benign
IGL02209:Synj1 APN 16 90987419 missense probably damaging 0.97
IGL02452:Synj1 APN 16 90961365 splice site probably benign
IGL02619:Synj1 APN 16 90974045 missense probably damaging 1.00
IGL02650:Synj1 APN 16 90976696 missense probably benign 0.03
IGL02708:Synj1 APN 16 90991462 missense probably damaging 1.00
IGL02863:Synj1 APN 16 90961434 missense possibly damaging 0.94
IGL03131:Synj1 APN 16 90988168 missense probably damaging 0.99
IGL03295:Synj1 APN 16 90938430 missense probably benign 0.14
IGL03356:Synj1 APN 16 90987392 missense probably damaging 1.00
PIT1430001:Synj1 UTSW 16 90964508 missense probably damaging 1.00
R0179:Synj1 UTSW 16 90964631 missense possibly damaging 0.80
R0396:Synj1 UTSW 16 90938640 missense probably benign
R0426:Synj1 UTSW 16 90967354 missense probably damaging 1.00
R0486:Synj1 UTSW 16 90938263 utr 3 prime probably benign
R0515:Synj1 UTSW 16 90994022 missense possibly damaging 0.93
R0535:Synj1 UTSW 16 90948087 missense possibly damaging 0.80
R0697:Synj1 UTSW 16 90960615 missense probably benign 0.44
R0698:Synj1 UTSW 16 90960615 missense probably benign 0.44
R0945:Synj1 UTSW 16 90960445 missense possibly damaging 0.90
R1327:Synj1 UTSW 16 90946855 missense probably benign 0.05
R1562:Synj1 UTSW 16 90987402 missense probably benign 0.09
R1732:Synj1 UTSW 16 90964230 missense probably damaging 0.99
R1752:Synj1 UTSW 16 90938473 missense probably benign
R1786:Synj1 UTSW 16 90964517 missense probably damaging 1.00
R2011:Synj1 UTSW 16 90938696 missense probably damaging 1.00
R2012:Synj1 UTSW 16 90938696 missense probably damaging 1.00
R2065:Synj1 UTSW 16 90991649 critical splice acceptor site probably null
R2862:Synj1 UTSW 16 90969329 missense probably damaging 1.00
R3026:Synj1 UTSW 16 90978734 missense probably damaging 1.00
R3151:Synj1 UTSW 16 90960626 missense probably damaging 0.96
R3946:Synj1 UTSW 16 91010096 missense possibly damaging 0.48
R3971:Synj1 UTSW 16 90991603 missense probably damaging 1.00
R4472:Synj1 UTSW 16 90969181 critical splice donor site probably null
R4547:Synj1 UTSW 16 90988282 missense possibly damaging 0.51
R4647:Synj1 UTSW 16 90973989 missense probably damaging 1.00
R4739:Synj1 UTSW 16 90955419 missense probably benign 0.00
R5027:Synj1 UTSW 16 90940519 intron probably null
R5428:Synj1 UTSW 16 90991518 missense probably damaging 0.98
R5586:Synj1 UTSW 16 91009977 intron probably benign
R5769:Synj1 UTSW 16 90938253 utr 3 prime probably benign
R6005:Synj1 UTSW 16 90969286 missense probably damaging 1.00
R6119:Synj1 UTSW 16 90938989 missense probably benign 0.30
R6313:Synj1 UTSW 16 90946815 missense probably benign 0.00
R6324:Synj1 UTSW 16 90938630 missense probably benign 0.00
R6549:Synj1 UTSW 16 90938677 missense probably benign
R6696:Synj1 UTSW 16 90960452 missense probably damaging 0.98
R6698:Synj1 UTSW 16 90960452 missense probably damaging 0.98
R6861:Synj1 UTSW 16 90963880 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gtatgtggaggtcagaggatag -3'
Posted On2014-05-23