Incidental Mutation 'R1770:Tdrd7'
ID196472
Institutional Source Beutler Lab
Gene Symbol Tdrd7
Ensembl Gene ENSMUSG00000035517
Gene Nametudor domain containing 7
Synonyms5730495N10Rik
MMRRC Submission 039801-MU
Accession Numbers

Genbank: NM_146142; MGI: 2140279

Is this an essential gene? Possibly essential (E-score: 0.665) question?
Stock #R1770 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location45965334-46034761 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 45987681 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102929] [ENSMUST00000107777]
Predicted Effect probably benign
Transcript: ENSMUST00000102929
SMART Domains Protein: ENSMUSP00000099993
Gene: ENSMUSG00000035517

DomainStartEndE-ValueType
Pfam:OST-HTH 3 73 2.6e-10 PFAM
internal_repeat_1 223 300 2.94e-9 PROSPERO
low complexity region 302 318 N/A INTRINSIC
internal_repeat_1 326 400 2.94e-9 PROSPERO
TUDOR 500 556 2.08e-5 SMART
TUDOR 690 746 1.66e-4 SMART
TUDOR 945 1001 4.03e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107777
SMART Domains Protein: ENSMUSP00000103406
Gene: ENSMUSG00000035517

DomainStartEndE-ValueType
Pfam:OST-HTH 36 106 5.7e-11 PFAM
internal_repeat_1 256 333 3.1e-9 PROSPERO
low complexity region 335 351 N/A INTRINSIC
internal_repeat_1 359 433 3.1e-9 PROSPERO
TUDOR 533 589 2.08e-5 SMART
TUDOR 723 779 1.66e-4 SMART
TUDOR 978 1034 4.03e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151422
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 92% (69/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Tudor family of proteins. This protein contains conserved Tudor domains and LOTUS domains. It is a component of RNA granules, which function in RNA processing. Mutations in this gene have been associated with cataract formation in mouse and human. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous inactivation of this gene causes arrest of spermatogenesis, male sterility, glaucoma, and cataracts. Aging mice homozygous for an ENU-induced (null) allele show additional ocular phenotypes including an enlarged anterior chamber, lens extrusion, a flat iris, uveitis, and optic neuropathy. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,418,021 T230S probably benign Het
Abcd4 T C 12: 84,615,100 T84A probably benign Het
Adgra1 T A 7: 139,874,031 Y161* probably null Het
Aldoart1 G T 4: 72,851,936 H212N probably benign Het
Aldob A G 4: 49,536,861 Y343H probably damaging Het
Ankrd17 A T 5: 90,243,376 V2036E possibly damaging Het
Ass1 A G 2: 31,486,516 T131A probably benign Het
Baz1a C T 12: 54,898,508 R1354H probably damaging Het
C2cd2l A G 9: 44,316,811 V71A probably benign Het
C4b T A 17: 34,736,927 N678I possibly damaging Het
Carmil1 A G 13: 24,173,674 L64P probably damaging Het
Cdh18 T C 15: 23,474,401 S786P probably benign Het
Cep135 A G 5: 76,603,195 E296G possibly damaging Het
Chml G A 1: 175,687,878 T159I probably benign Het
Cntn3 C T 6: 102,269,205 E328K possibly damaging Het
Cstf1 A G 2: 172,373,063 I35V possibly damaging Het
Cyp2c65 A G 19: 39,082,198 K275R probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbx2 T C 15: 95,624,734 E364G probably benign Het
Dcaf13 A T 15: 39,130,238 N242I probably damaging Het
Dcc A G 18: 71,446,399 V701A probably benign Het
Fastkd5 A T 2: 130,614,280 Y797N probably damaging Het
Fat4 T A 3: 39,010,268 I4791K probably damaging Het
Gm3852 T C 1: 46,011,888 I45V possibly damaging Het
Gng4 A G 13: 13,825,266 D40G probably damaging Het
Gns A G 10: 121,378,047 D209G probably benign Het
Kif6 C A 17: 49,903,649 Q791K possibly damaging Het
Klhl35 G A 7: 99,473,875 V569M possibly damaging Het
Krt2 A G 15: 101,811,154 S694P unknown Het
Lrrc8c A G 5: 105,606,737 Y126C probably damaging Het
Mad2l1bp A G 17: 46,152,912 V62A probably benign Het
Map1b T C 13: 99,430,493 R1907G unknown Het
Mertk A G 2: 128,750,174 I273V probably benign Het
Mfsd4b1 A G 10: 40,003,227 Y225H probably damaging Het
Mrc2 T C 11: 105,338,793 V684A probably damaging Het
Msh6 G A 17: 87,980,223 W97* probably null Het
Mtmr10 A G 7: 64,336,721 I516V possibly damaging Het
Myo7a A T 7: 98,112,606 probably benign Het
Ndufs5 T C 4: 123,712,868 Y92C probably benign Het
Nlrp1b C T 11: 71,160,153 V1035I probably benign Het
Ntrk2 A G 13: 58,861,318 R308G possibly damaging Het
Olfr1148 A G 2: 87,833,299 I87V probably benign Het
Pcdhb16 G T 18: 37,479,180 G398W probably damaging Het
Plpbp T A 8: 27,053,298 S237T probably damaging Het
Pnpla6 T A 8: 3,534,634 F769I possibly damaging Het
Polk A G 13: 96,495,442 V261A probably damaging Het
Prss52 C T 14: 64,113,633 A289V probably damaging Het
Puf60 T C 15: 76,070,874 K407E probably benign Het
Pzp T C 6: 128,485,617 D1455G probably damaging Het
Ranbp17 T C 11: 33,217,301 N1054S probably benign Het
Sdk2 A G 11: 113,793,741 S1965P probably benign Het
Spryd7 T C 14: 61,540,205 Y142C probably damaging Het
Srrt A T 5: 137,299,860 probably benign Het
Stk10 A G 11: 32,622,464 E935G possibly damaging Het
Tas2r115 G A 6: 132,737,971 R6C probably damaging Het
Trim29 A T 9: 43,332,376 Q564L probably damaging Het
Trim5 T C 7: 104,276,661 D231G probably damaging Het
Trpv2 A G 11: 62,596,961 K676E probably benign Het
Ttn T C 2: 76,753,515 R22383G probably damaging Het
Ugt1a2 A G 1: 88,201,438 I268V probably benign Het
Ugt8a T C 3: 125,874,203 N330D probably benign Het
Utrn G A 10: 12,475,296 H2822Y probably damaging Het
Vmn1r176 G A 7: 23,835,521 A69V probably benign Het
Vmn2r106 T C 17: 20,268,298 Y613C probably damaging Het
Wdfy1 A T 1: 79,709,140 W296R probably damaging Het
Zfp11 G A 5: 129,657,758 T213I possibly damaging Het
Zfp142 A T 1: 74,579,631 F193I probably damaging Het
Zfp764 G A 7: 127,405,567 Q131* probably null Het
Other mutations in Tdrd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Tdrd7 APN 4 46010889 missense probably damaging 1.00
IGL01541:Tdrd7 APN 4 46018551 missense possibly damaging 0.90
IGL01901:Tdrd7 APN 4 45989225 splice site probably benign
IGL02812:Tdrd7 APN 4 45994406 missense probably benign 0.08
A5278:Tdrd7 UTSW 4 46007622 missense probably benign 0.01
R0049:Tdrd7 UTSW 4 45987582 missense probably damaging 1.00
R0049:Tdrd7 UTSW 4 45987582 missense probably damaging 1.00
R0389:Tdrd7 UTSW 4 46016987 missense probably benign 0.01
R0452:Tdrd7 UTSW 4 45965488 splice site probably benign
R0639:Tdrd7 UTSW 4 45989102 missense probably benign 0.00
R0681:Tdrd7 UTSW 4 46016879 missense probably benign 0.45
R0925:Tdrd7 UTSW 4 46025758 missense probably damaging 1.00
R0944:Tdrd7 UTSW 4 46029762 missense probably benign 0.01
R1586:Tdrd7 UTSW 4 45994445 missense probably benign 0.39
R1945:Tdrd7 UTSW 4 45965474 missense probably benign 0.00
R4400:Tdrd7 UTSW 4 46005540 missense possibly damaging 0.87
R4457:Tdrd7 UTSW 4 46007526 missense probably benign 0.04
R4898:Tdrd7 UTSW 4 46005616 missense possibly damaging 0.94
R5152:Tdrd7 UTSW 4 46013191 missense probably damaging 1.00
R5197:Tdrd7 UTSW 4 46034350 missense probably damaging 1.00
R5326:Tdrd7 UTSW 4 46029757 missense probably benign 0.01
R5473:Tdrd7 UTSW 4 46020877 missense possibly damaging 0.95
R5524:Tdrd7 UTSW 4 46034301 missense probably benign 0.31
R5542:Tdrd7 UTSW 4 46029757 missense probably benign 0.01
R5554:Tdrd7 UTSW 4 46005358 missense possibly damaging 0.92
R5588:Tdrd7 UTSW 4 45992225 missense probably benign 0.18
R5776:Tdrd7 UTSW 4 46005689 missense probably benign 0.00
R5786:Tdrd7 UTSW 4 45989082 missense probably benign 0.09
R6063:Tdrd7 UTSW 4 46005486 missense probably benign 0.00
R6340:Tdrd7 UTSW 4 45994517 missense probably damaging 0.99
X0063:Tdrd7 UTSW 4 45992268 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCAAAGATGCTAAGGGCTGTCCTG -3'
(R):5'- ACAAAAGAGCTTGTCCTCCGACTG -3'

Sequencing Primer
(F):5'- TGCAGTCTCATAAGAACGGG -3'
(R):5'- GTGAGAATATCCCAAATTCCCTGG -3'
Posted On2014-05-23