Incidental Mutation 'R0081:Frmd4a'
ID19654
Institutional Source Beutler Lab
Gene Symbol Frmd4a
Ensembl Gene ENSMUSG00000026657
Gene NameFERM domain containing 4A
SynonymsGm13190, 2700017I06Rik, C230040M21Rik
MMRRC Submission 038368-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R0081 (G1)
Quality Score172
Status Validated
Chromosome2
Chromosomal Location4017717-4614043 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 4572441 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075767] [ENSMUST00000091497] [ENSMUST00000175669] [ENSMUST00000175944] [ENSMUST00000176828] [ENSMUST00000176864] [ENSMUST00000177457]
Predicted Effect probably null
Transcript: ENSMUST00000075767
SMART Domains Protein: ENSMUSP00000075172
Gene: ENSMUSG00000026657

DomainStartEndE-ValueType
B41 1 206 3.24e-40 SMART
FERM_C 210 311 7.69e-27 SMART
Pfam:DUF3338 340 477 1.9e-63 PFAM
low complexity region 558 571 N/A INTRINSIC
low complexity region 610 623 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
low complexity region 764 785 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000091497
SMART Domains Protein: ENSMUSP00000089079
Gene: ENSMUSG00000026657

DomainStartEndE-ValueType
B41 12 217 3.24e-40 SMART
FERM_C 221 322 7.69e-27 SMART
Pfam:DUF3338 352 487 6.3e-61 PFAM
low complexity region 569 582 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 743 752 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
low complexity region 801 812 N/A INTRINSIC
low complexity region 935 958 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153160
Predicted Effect probably null
Transcript: ENSMUST00000175669
SMART Domains Protein: ENSMUSP00000135306
Gene: ENSMUSG00000026657

DomainStartEndE-ValueType
B41 31 236 3.24e-40 SMART
FERM_C 240 341 7.69e-27 SMART
low complexity region 371 387 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000175944
SMART Domains Protein: ENSMUSP00000135686
Gene: ENSMUSG00000026657

DomainStartEndE-ValueType
B41 49 254 3.24e-40 SMART
FERM_C 258 359 7.69e-27 SMART
Pfam:DUF3338 388 525 6.5e-64 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000176828
SMART Domains Protein: ENSMUSP00000134803
Gene: ENSMUSG00000026657

DomainStartEndE-ValueType
Pfam:DUF3338 46 183 4.1e-64 PFAM
low complexity region 264 277 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
low complexity region 438 447 N/A INTRINSIC
low complexity region 470 491 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
low complexity region 630 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176864
SMART Domains Protein: ENSMUSP00000135057
Gene: ENSMUSG00000026657

DomainStartEndE-ValueType
Pfam:DUF3338 35 150 2.6e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177457
SMART Domains Protein: ENSMUSP00000134788
Gene: ENSMUSG00000026657

DomainStartEndE-ValueType
B41 16 221 3.24e-40 SMART
FERM_C 225 326 7.69e-27 SMART
Pfam:DUF3338 355 492 3.9e-63 PFAM
low complexity region 573 586 N/A INTRINSIC
low complexity region 625 638 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 800 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 939 962 N/A INTRINSIC
Meta Mutation Damage Score 0.51 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.2%
  • 10x: 88.5%
  • 20x: 63.6%
Validation Efficiency 94% (159/169)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a FERM domain-containing protein that regulates epithelial cell polarity. It connects ADP ribosylation factor 6 (ARF6) with the Par protein complex, which regulates the remodeling of adherens junctions and linear actin cable formation during epithelial cell polarization. Polymorphisms in this gene are associated with Alzheimer's disease, and also with nicotine dependence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T C 8: 24,781,687 D485G probably damaging Het
Adamts19 T C 18: 58,903,065 probably null Het
Adgrd1 A T 5: 129,178,082 I598F probably damaging Het
Adh5 A G 3: 138,451,413 D245G probably benign Het
Adra2b T C 2: 127,364,292 V238A probably benign Het
Ank1 G A 8: 23,116,242 V1188I possibly damaging Het
Asap1 C T 15: 64,099,564 G905D probably damaging Het
AW554918 T C 18: 25,344,902 V428A probably benign Het
Birc6 T A 17: 74,643,441 S3226T probably benign Het
Cdh17 A T 4: 11,785,280 probably benign Het
Cyfip2 A T 11: 46,253,998 Y676* probably null Het
Dcaf17 T A 2: 71,078,468 probably benign Het
Dclre1a A G 19: 56,542,707 F736L probably damaging Het
Ddx41 A T 13: 55,535,380 H171Q possibly damaging Het
Dennd5b G T 6: 148,993,759 Q1258K probably benign Het
Dock10 T C 1: 80,606,578 D137G probably damaging Het
Dpyd G A 3: 118,944,255 V482I probably benign Het
Erich6 A T 3: 58,636,126 probably benign Het
Fam193b A G 13: 55,554,211 probably benign Het
Foxp2 T C 6: 15,405,644 probably benign Het
Gas2l2 A G 11: 83,422,867 S540P possibly damaging Het
Glis2 T C 16: 4,613,653 V348A probably benign Het
Gm14443 C A 2: 175,169,936 G239V probably damaging Het
Gpr158 T C 2: 21,826,717 V876A probably damaging Het
H1foo A G 6: 115,949,981 E273G probably benign Het
Hadh C T 3: 131,235,636 D245N probably damaging Het
Hk2 A T 6: 82,734,976 probably benign Het
Ice1 A T 13: 70,619,044 Y108* probably null Het
Il10ra T G 9: 45,255,949 M435L probably benign Het
Inpp5k GT G 11: 75,631,147 probably null Het
Kank4 G T 4: 98,778,330 P627T probably benign Het
Kif16b A G 2: 142,707,426 probably benign Het
Lipn A G 19: 34,076,976 I205V probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myh1 T C 11: 67,215,857 M1255T probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo1d T G 11: 80,557,523 K925N probably benign Het
Myoz1 T A 14: 20,649,554 M239L probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nf1 C A 11: 79,453,979 probably benign Het
Npepl1 C T 2: 174,116,086 P239S probably damaging Het
Olfml1 A G 7: 107,571,299 K131R probably benign Het
Olfr1258 T A 2: 89,930,079 I90K possibly damaging Het
Olfr1303 A C 2: 111,813,868 I286S probably damaging Het
Olfr344 T A 2: 36,568,881 Y94* probably null Het
Olfr352 T C 2: 36,870,010 L148S possibly damaging Het
Olfr358 G A 2: 37,005,450 L55F probably damaging Het
Olfr389 A G 11: 73,777,109 F73L possibly damaging Het
Olfr472 C T 7: 107,903,005 T96I probably benign Het
Olfr771 C T 10: 129,160,838 D49N possibly damaging Het
Pde7a T C 3: 19,241,533 probably benign Het
Pik3c2g T C 6: 139,957,793 C591R probably benign Het
Pkn2 T G 3: 142,853,582 K61Q probably damaging Het
Ppfia1 C A 7: 144,504,974 G722C probably damaging Het
Ppp1cb T C 5: 32,487,614 V263A probably damaging Het
Rab11fip2 A T 19: 59,907,135 N440K possibly damaging Het
Rbm34 T A 8: 126,949,484 K340N probably damaging Het
Samd3 T C 10: 26,271,501 probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sigirr T C 7: 141,091,372 D399G probably damaging Het
Slc17a7 A G 7: 45,174,947 E554G probably benign Het
Smc3 A G 19: 53,601,562 probably benign Het
Tdrd1 T C 19: 56,831,271 Y68H probably benign Het
Tespa1 T A 10: 130,360,850 L219Q probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Ttc38 A G 15: 85,856,472 S436G probably benign Het
Ttn T A 2: 76,751,079 I23157F probably damaging Het
Ubxn2b T A 4: 6,203,875 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r72 T C 7: 85,751,836 E125G probably benign Het
Vmn2r78 A T 7: 86,923,027 D532V probably benign Het
Vwa8 C A 14: 79,082,782 L1078I probably benign Het
Vwce A T 19: 10,664,089 probably null Het
Zpr1 A G 9: 46,279,697 D300G probably damaging Het
Other mutations in Frmd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Frmd4a APN 2 4594714 missense probably benign 0.00
IGL00508:Frmd4a APN 2 4594734 nonsense probably null
IGL01331:Frmd4a APN 2 4602225 missense probably benign 0.32
IGL01774:Frmd4a APN 2 4535236 splice site probably benign
IGL01909:Frmd4a APN 2 4604033 missense probably benign 0.11
IGL02170:Frmd4a APN 2 4566177 missense probably damaging 0.99
IGL02269:Frmd4a APN 2 4604234 missense probably benign 0.19
IGL02377:Frmd4a APN 2 4534574 missense possibly damaging 0.47
IGL03308:Frmd4a APN 2 4498026 missense possibly damaging 0.95
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0128:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0130:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0376:Frmd4a UTSW 2 4572387 missense probably damaging 0.97
R0529:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R0549:Frmd4a UTSW 2 4603967 missense possibly damaging 0.76
R1593:Frmd4a UTSW 2 4473188 missense probably damaging 1.00
R1959:Frmd4a UTSW 2 4535186 missense probably damaging 1.00
R2002:Frmd4a UTSW 2 4572365 missense probably damaging 1.00
R2100:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R2310:Frmd4a UTSW 2 4572399 frame shift probably null
R2340:Frmd4a UTSW 2 4586376 missense probably damaging 1.00
R2426:Frmd4a UTSW 2 4529862 missense probably damaging 1.00
R2680:Frmd4a UTSW 2 4534553 missense probably damaging 1.00
R3409:Frmd4a UTSW 2 4153028 intron probably benign
R3772:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3773:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3932:Frmd4a UTSW 2 4537260 missense probably damaging 1.00
R4094:Frmd4a UTSW 2 4611032 missense probably damaging 1.00
R4226:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4299:Frmd4a UTSW 2 4333071 missense probably benign 0.02
R4304:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4306:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4307:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4346:Frmd4a UTSW 2 4608033 missense possibly damaging 0.92
R4360:Frmd4a UTSW 2 4601241 missense probably damaging 1.00
R4384:Frmd4a UTSW 2 4594563 nonsense probably null
R4547:Frmd4a UTSW 2 4473145 missense probably damaging 1.00
R4575:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4577:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4578:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4688:Frmd4a UTSW 2 4537311 missense possibly damaging 0.81
R4764:Frmd4a UTSW 2 4603448 missense probably damaging 1.00
R4826:Frmd4a UTSW 2 4601297 missense probably damaging 1.00
R4879:Frmd4a UTSW 2 4529817 missense probably damaging 1.00
R5053:Frmd4a UTSW 2 4603921 missense probably damaging 1.00
R5392:Frmd4a UTSW 2 4594573 missense probably damaging 1.00
R5733:Frmd4a UTSW 2 4300957 missense possibly damaging 0.53
R5762:Frmd4a UTSW 2 4484065 missense probably damaging 1.00
R5920:Frmd4a UTSW 2 4333116 missense probably benign 0.02
R5932:Frmd4a UTSW 2 4529839 missense probably damaging 1.00
R6117:Frmd4a UTSW 2 4602249 missense possibly damaging 0.66
R6328:Frmd4a UTSW 2 4590698 missense probably damaging 0.99
R6622:Frmd4a UTSW 2 4606062 missense probably benign 0.00
R6903:Frmd4a UTSW 2 4586456 missense probably damaging 1.00
R7065:Frmd4a UTSW 2 4566112
R7098:Frmd4a UTSW 2 4572433 missense probably damaging 1.00
R7258:Frmd4a UTSW 2 4300953 missense probably benign
R7336:Frmd4a UTSW 2 4473214 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGTTTGTGTAGCTTACGAGCCACC -3'
(R):5'- GCACTGACAATTTGTGCCTCACTG -3'

Sequencing Primer
(F):5'- GGGCTTACAAGTAGGCAAGTATTTTC -3'
(R):5'- TGTGCCTCACTGAAGTTACAC -3'
Posted On2013-04-11