Incidental Mutation 'R1771:Asph'
ID196559
Institutional Source Beutler Lab
Gene Symbol Asph
Ensembl Gene ENSMUSG00000028207
Gene Nameaspartate-beta-hydroxylase
Synonymsaspartyl beta-hydroxylase, BAH, calsequestrin-binding protein, jumbug, 2310005F16Rik, 3110001L23Rik, junctate, cI-37, Junctin
MMRRC Submission 039802-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1771 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location9448069-9669344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9598773 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 149 (S149R)
Ref Sequence ENSEMBL: ENSMUSP00000103972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078139] [ENSMUST00000084915] [ENSMUST00000108333] [ENSMUST00000108334] [ENSMUST00000108335] [ENSMUST00000108337] [ENSMUST00000108339] [ENSMUST00000108340]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078139
AA Change: S244R

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077273
Gene: ENSMUSG00000028207
AA Change: S244R

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 307 7e-104 PFAM
Pfam:TPR_6 326 357 4.4e-5 PFAM
Pfam:TPR_16 328 398 1.3e-9 PFAM
Pfam:TPR_2 439 470 2.6e-4 PFAM
Pfam:TPR_8 441 470 1.7e-3 PFAM
Pfam:Asp_Arg_Hydrox 574 728 7.6e-58 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000084915
AA Change: S244R

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081978
Gene: ENSMUSG00000028207
AA Change: S244R

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 307 6.2e-105 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108333
AA Change: S195R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103970
Gene: ENSMUSG00000028207
AA Change: S195R

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 14 128 5.8e-59 PFAM
Pfam:Asp-B-Hydro_N 121 258 8.8e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108334
AA Change: S206R

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103971
Gene: ENSMUSG00000028207
AA Change: S206R

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 14 269 3.8e-105 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108335
AA Change: S149R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103972
Gene: ENSMUSG00000028207
AA Change: S149R

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 14 84 1.6e-49 PFAM
Pfam:Asp-B-Hydro_N 79 212 1.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108337
SMART Domains Protein: ENSMUSP00000103974
Gene: ENSMUSG00000028207

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 291 1.8e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108339
SMART Domains Protein: ENSMUSP00000103976
Gene: ENSMUSG00000028207

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 1 224 1.6e-80 PFAM
Pfam:TPR_6 243 274 1.4e-4 PFAM
Pfam:TPR_16 245 315 2.5e-9 PFAM
Pfam:TPR_2 356 387 7e-4 PFAM
Pfam:Asp_Arg_Hydrox 489 646 5.3e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108340
SMART Domains Protein: ENSMUSP00000103977
Gene: ENSMUSG00000028207

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 291 8.6e-96 PFAM
Pfam:TPR_6 310 341 1.9e-4 PFAM
Pfam:TPR_16 312 382 2.9e-9 PFAM
Pfam:TPR_2 423 454 6.8e-4 PFAM
Pfam:Asp_Arg_Hydrox 556 713 3.8e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124408
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play an important role in calcium homeostasis. The gene is expressed from two promoters and undergoes extensive alternative splicing. The encoded set of proteins share varying amounts of overlap near their N-termini but have substantial variations in their C-terminal domains resulting in distinct functional properties. The longest isoforms (a and f) include a C-terminal Aspartyl/Asparaginyl beta-hydroxylase domain that hydroxylates aspartic acid or asparagine residues in the epidermal growth factor (EGF)-like domains of some proteins, including protein C, coagulation factors VII, IX, and X, and the complement factors C1R and C1S. Other isoforms differ primarily in the C-terminal sequence and lack the hydroxylase domain, and some have been localized to the endoplasmic and sarcoplasmic reticulum. Some of these isoforms are found in complexes with calsequestrin, triadin, and the ryanodine receptor, and have been shown to regulate calcium release from the sarcoplasmic reticulum. Some isoforms have been implicated in metastasis. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for a mutation lacking aspartyl beta-hydroxylase expression exhibit syndactyly, facial dysmorphology, mild hard palate defects, and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 106,937,200 S642P probably damaging Het
Adam30 T C 3: 98,161,519 S95P possibly damaging Het
Ahnak G A 19: 9,013,753 V4134I probably benign Het
AI314180 A G 4: 58,879,100 I63T probably damaging Het
Ankrd13a T C 5: 114,803,588 V512A probably benign Het
Atp2b4 C A 1: 133,732,393 V384L probably damaging Het
Atp8a1 A G 5: 67,647,731 W1014R probably damaging Het
Cand1 A C 10: 119,208,306 N1054K probably benign Het
Car15 A T 16: 17,836,866 V96E probably damaging Het
Ccdc129 T C 6: 55,898,147 S361P probably benign Het
Cd1d1 T C 3: 86,998,665 E101G possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Ceacam1 T A 7: 25,472,044 T332S probably benign Het
Clca2 A T 3: 145,081,410 V500E probably benign Het
Cul9 A T 17: 46,537,812 M666K probably benign Het
Dennd3 A G 15: 73,555,101 T776A possibly damaging Het
Dennd5a T C 7: 109,918,686 D581G probably damaging Het
Dgkh A G 14: 78,609,527 V371A probably damaging Het
Dhcr24 A G 4: 106,578,253 T314A probably benign Het
Diaph1 G T 18: 37,891,018 P589Q unknown Het
Disp2 C T 2: 118,791,297 Q837* probably null Het
Dusp3 A T 11: 101,984,735 M1K probably null Het
Epp13 G T 7: 6,277,542 probably null Het
Erich3 A C 3: 154,748,472 D625A possibly damaging Het
Fat2 G A 11: 55,310,865 S461L probably benign Het
Fmn2 A G 1: 174,608,776 probably benign Het
Foxi1 A G 11: 34,207,594 Y144H probably damaging Het
Ftcd G A 10: 76,587,368 V458M probably damaging Het
Gm3604 C A 13: 62,370,074 G157* probably null Het
Gnpda1 C T 18: 38,333,327 R79Q probably benign Het
Gpr65 T A 12: 98,276,000 I304K probably damaging Het
Grem1 T C 2: 113,749,676 E160G probably benign Het
Gria2 T A 3: 80,692,301 K759* probably null Het
Gsg1l A G 7: 125,958,573 S128P probably damaging Het
Hdac1 A T 4: 129,521,428 I240N probably damaging Het
Hic2 C T 16: 17,258,714 T469M probably benign Het
Hoxc10 A C 15: 102,967,087 D77A probably damaging Het
Klhl14 T A 18: 21,651,620 H250L probably damaging Het
Klk1b24 A G 7: 44,188,229 probably null Het
Letm1 T A 5: 33,769,467 H162L probably damaging Het
Loxl3 A T 6: 83,049,909 Y573F probably damaging Het
Macf1 A T 4: 123,512,108 I330N probably damaging Het
Mchr1 T A 15: 81,237,235 I62N probably damaging Het
Mcm8 C T 2: 132,843,556 Q803* probably null Het
Msh3 T G 13: 92,212,496 D1075A probably benign Het
Msh6 T A 17: 87,984,522 V235D probably benign Het
Mthfd2l A T 5: 90,974,395 D253V probably damaging Het
Mtor T C 4: 148,470,624 V901A possibly damaging Het
Muc20 A T 16: 32,793,852 I385N probably damaging Het
Myo6 G T 9: 80,285,800 C829F probably damaging Het
Nbea T C 3: 55,934,519 I1914V probably benign Het
Ncor1 T C 11: 62,327,112 E1462G probably damaging Het
Necab1 A G 4: 15,111,267 Y54H probably damaging Het
Nlrp4b A G 7: 10,718,593 K15R probably damaging Het
Ntrk1 A G 3: 87,789,630 S139P probably benign Het
Oas1d T C 5: 120,915,837 F120S probably damaging Het
Ofd1 A G X: 166,406,006 Y755H probably benign Het
Olfr118 A G 17: 37,672,663 I213M probably damaging Het
Olfr1317 T G 2: 112,142,720 Y258* probably null Het
Olfr1412 A G 1: 92,589,115 I262V probably benign Het
Olfr368 T A 2: 37,332,418 F224I probably benign Het
Olfr482 A C 7: 108,095,609 probably null Het
Olfr539 A G 7: 140,668,135 T276A probably benign Het
Plekha6 T C 1: 133,273,913 S355P probably benign Het
Prdm14 T C 1: 13,118,858 K421E probably damaging Het
Prss36 A G 7: 127,933,453 L731P probably damaging Het
Rad51d A G 11: 82,883,938 L97P probably damaging Het
Rbl1 C A 2: 157,163,534 probably null Het
Rnh1 G T 7: 141,164,606 A52D possibly damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Ryr2 A C 13: 11,745,176 probably null Het
Samd4 A T 14: 47,089,075 N454I probably damaging Het
Sap130 T C 18: 31,636,082 I32T probably benign Het
Sap30l A T 11: 57,806,099 N85I probably damaging Het
Sbf2 G A 7: 110,461,146 Q204* probably null Het
Slc45a3 T C 1: 131,976,956 W6R possibly damaging Het
Snx16 A G 3: 10,419,161 V334A probably damaging Het
Soat1 C T 1: 156,442,421 V143I probably benign Het
Sp8 T A 12: 118,849,567 F386I probably damaging Het
Spag6 C T 2: 18,734,117 S286L probably benign Het
Srpr A T 9: 35,212,851 N31I possibly damaging Het
Ssbp4 A G 8: 70,598,852 probably null Het
Stxbp2 G T 8: 3,634,064 A124S probably benign Het
Tacc2 A G 7: 130,742,240 K700R probably damaging Het
Tatdn2 A T 6: 113,702,099 probably null Het
Tecrl G A 5: 83,291,287 T226I probably damaging Het
Timeless T G 10: 128,247,608 V702G probably benign Het
Tjp1 A T 7: 65,313,005 S1061R probably benign Het
Tmem39b A T 4: 129,693,218 C67S probably damaging Het
Tstd3 T C 4: 21,759,475 Y99C probably damaging Het
Ttc39c T A 18: 12,684,824 probably null Het
Ttll7 C T 3: 146,894,405 P23S probably benign Het
Uba5 A G 9: 104,049,908 F290S probably damaging Het
Ubap2l T C 3: 90,019,231 Y623C probably damaging Het
Ube3a A G 7: 59,275,966 E164G probably damaging Het
Ugcg A G 4: 59,207,775 N38S probably benign Het
Ugp2 G A 11: 21,329,915 T283I probably damaging Het
Vmn1r55 A T 7: 5,146,920 I168N probably benign Het
Wdr27 A C 17: 14,892,441 S668A probably damaging Het
Wnt2 T A 6: 18,008,697 N247I probably damaging Het
Zfp850 A T 7: 27,985,275 C15* probably null Het
Zfp959 A G 17: 55,897,677 probably null Het
Other mutations in Asph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Asph APN 4 9639322 missense probably damaging 1.00
IGL00928:Asph APN 4 9594675 missense probably benign 0.07
IGL01022:Asph APN 4 9601344 missense possibly damaging 0.63
IGL01677:Asph APN 4 9607853 missense probably damaging 1.00
IGL01907:Asph APN 4 9514643 missense possibly damaging 0.59
IGL01958:Asph APN 4 9474904 missense possibly damaging 0.93
IGL01976:Asph APN 4 9475471 missense probably damaging 0.98
IGL01989:Asph APN 4 9602462 splice site probably benign
IGL02379:Asph APN 4 9474980 missense probably damaging 1.00
IGL02444:Asph APN 4 9542319 splice site probably benign
IGL02652:Asph APN 4 9529984 missense probably benign 0.11
IGL02679:Asph APN 4 9601349 missense possibly damaging 0.63
IGL02735:Asph APN 4 9598759 missense probably damaging 1.00
IGL02875:Asph APN 4 9595380 missense probably damaging 1.00
IGL03022:Asph APN 4 9517668 missense possibly damaging 0.48
R0026:Asph UTSW 4 9601361 missense probably damaging 0.97
R0121:Asph UTSW 4 9635918 missense probably damaging 1.00
R0357:Asph UTSW 4 9453314 missense probably benign 0.01
R0410:Asph UTSW 4 9595415 missense probably damaging 1.00
R0554:Asph UTSW 4 9604581 missense probably damaging 0.99
R0577:Asph UTSW 4 9604620 missense probably benign 0.02
R0718:Asph UTSW 4 9514683 splice site probably benign
R0725:Asph UTSW 4 9542275 missense probably damaging 1.00
R1383:Asph UTSW 4 9537807 intron probably null
R1654:Asph UTSW 4 9453315 missense probably benign 0.31
R1694:Asph UTSW 4 9610869 missense probably damaging 0.99
R1776:Asph UTSW 4 9598773 missense probably damaging 0.99
R1840:Asph UTSW 4 9601340 missense possibly damaging 0.60
R1911:Asph UTSW 4 9453335 missense probably damaging 1.00
R1912:Asph UTSW 4 9453335 missense probably damaging 1.00
R2117:Asph UTSW 4 9517671 nonsense probably null
R2860:Asph UTSW 4 9598277 missense probably damaging 1.00
R2861:Asph UTSW 4 9598277 missense probably damaging 1.00
R2937:Asph UTSW 4 9542314 splice site probably benign
R3907:Asph UTSW 4 9474934 missense probably benign 0.23
R4154:Asph UTSW 4 9639250 nonsense probably null
R4623:Asph UTSW 4 9622005 missense possibly damaging 0.50
R4871:Asph UTSW 4 9531968 missense probably benign 0.02
R5196:Asph UTSW 4 9607830 missense probably damaging 0.99
R5540:Asph UTSW 4 9635906 missense probably damaging 1.00
R5757:Asph UTSW 4 9637722 intron probably null
R6063:Asph UTSW 4 9531960 missense probably benign 0.05
R6072:Asph UTSW 4 9643533 critical splice donor site probably null
R7016:Asph UTSW 4 9630604 intron probably null
R7133:Asph UTSW 4 9484575 missense probably benign 0.01
R7154:Asph UTSW 4 9630930 missense possibly damaging 0.85
R7201:Asph UTSW 4 9474917 missense probably damaging 1.00
R7316:Asph UTSW 4 9537746 missense probably benign 0.11
Z1088:Asph UTSW 4 9630715 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCCAGTAGGAGATGAGACAGAAGCTC -3'
(R):5'- ACTTACGCCGCAGTGATACAATGAC -3'

Sequencing Primer
(F):5'- GATGAGACAGAAGCTCATAACACTC -3'
(R):5'- CCAATTAACAGTcaattgtgccac -3'
Posted On2014-05-23