Incidental Mutation 'R1771:Dennd5a'
ID196590
Institutional Source Beutler Lab
Gene Symbol Dennd5a
Ensembl Gene ENSMUSG00000035901
Gene NameDENN/MADD domain containing 5A
Synonyms1500012B19Rik, Rab6ip1, ORF37
MMRRC Submission 039802-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R1771 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location109893780-109960470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109918686 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 581 (D581G)
Ref Sequence ENSEMBL: ENSMUSP00000102333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080437] [ENSMUST00000106722]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080437
AA Change: D605G

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079295
Gene: ENSMUSG00000035901
AA Change: D605G

DomainStartEndE-ValueType
uDENN 12 138 7.71e-45 SMART
DENN 202 390 9.28e-80 SMART
dDENN 512 588 4.06e-21 SMART
low complexity region 832 844 N/A INTRINSIC
RUN 884 947 4.9e-22 SMART
Pfam:PLAT 956 1062 1e-15 PFAM
RUN 1218 1278 3.69e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106722
AA Change: D581G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102333
Gene: ENSMUSG00000035901
AA Change: D581G

DomainStartEndE-ValueType
uDENN 12 114 2.32e-39 SMART
DENN 178 366 9.28e-80 SMART
dDENN 488 564 4.06e-21 SMART
low complexity region 808 820 N/A INTRINSIC
RUN 860 923 4.9e-22 SMART
Pfam:PLAT 932 1038 2.8e-18 PFAM
RUN 1194 1254 3.69e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154002
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN-domain-containing protein that functions as a RAB-activating guanine nucleotide exchange factor (GEF). This protein catalyzes the conversion of GDP to GTP and thereby converts inactive GDP-bound Rab proteins into their active GTP-bound form. The encoded protein is recruited by RAB6 onto Golgi membranes and is therefore referred to as RAB6-interacting protein 1. This protein binds with RAB39 as well. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene are associated with early infantile epileptic encephalopathy-49. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 106,937,200 S642P probably damaging Het
Adam30 T C 3: 98,161,519 S95P possibly damaging Het
Ahnak G A 19: 9,013,753 V4134I probably benign Het
AI314180 A G 4: 58,879,100 I63T probably damaging Het
Ankrd13a T C 5: 114,803,588 V512A probably benign Het
Asph A T 4: 9,598,773 S149R probably damaging Het
Atp2b4 C A 1: 133,732,393 V384L probably damaging Het
Atp8a1 A G 5: 67,647,731 W1014R probably damaging Het
Cand1 A C 10: 119,208,306 N1054K probably benign Het
Car15 A T 16: 17,836,866 V96E probably damaging Het
Ccdc129 T C 6: 55,898,147 S361P probably benign Het
Cd1d1 T C 3: 86,998,665 E101G possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Ceacam1 T A 7: 25,472,044 T332S probably benign Het
Clca2 A T 3: 145,081,410 V500E probably benign Het
Cul9 A T 17: 46,537,812 M666K probably benign Het
Dennd3 A G 15: 73,555,101 T776A possibly damaging Het
Dgkh A G 14: 78,609,527 V371A probably damaging Het
Dhcr24 A G 4: 106,578,253 T314A probably benign Het
Diaph1 G T 18: 37,891,018 P589Q unknown Het
Disp2 C T 2: 118,791,297 Q837* probably null Het
Dusp3 A T 11: 101,984,735 M1K probably null Het
Epp13 G T 7: 6,277,542 probably null Het
Erich3 A C 3: 154,748,472 D625A possibly damaging Het
Fat2 G A 11: 55,310,865 S461L probably benign Het
Fmn2 A G 1: 174,608,776 probably benign Het
Foxi1 A G 11: 34,207,594 Y144H probably damaging Het
Ftcd G A 10: 76,587,368 V458M probably damaging Het
Gm3604 C A 13: 62,370,074 G157* probably null Het
Gnpda1 C T 18: 38,333,327 R79Q probably benign Het
Gpr65 T A 12: 98,276,000 I304K probably damaging Het
Grem1 T C 2: 113,749,676 E160G probably benign Het
Gria2 T A 3: 80,692,301 K759* probably null Het
Gsg1l A G 7: 125,958,573 S128P probably damaging Het
Hdac1 A T 4: 129,521,428 I240N probably damaging Het
Hic2 C T 16: 17,258,714 T469M probably benign Het
Hoxc10 A C 15: 102,967,087 D77A probably damaging Het
Klhl14 T A 18: 21,651,620 H250L probably damaging Het
Klk1b24 A G 7: 44,188,229 probably null Het
Letm1 T A 5: 33,769,467 H162L probably damaging Het
Loxl3 A T 6: 83,049,909 Y573F probably damaging Het
Macf1 A T 4: 123,512,108 I330N probably damaging Het
Mchr1 T A 15: 81,237,235 I62N probably damaging Het
Mcm8 C T 2: 132,843,556 Q803* probably null Het
Msh3 T G 13: 92,212,496 D1075A probably benign Het
Msh6 T A 17: 87,984,522 V235D probably benign Het
Mthfd2l A T 5: 90,974,395 D253V probably damaging Het
Mtor T C 4: 148,470,624 V901A possibly damaging Het
Muc20 A T 16: 32,793,852 I385N probably damaging Het
Myo6 G T 9: 80,285,800 C829F probably damaging Het
Nbea T C 3: 55,934,519 I1914V probably benign Het
Ncor1 T C 11: 62,327,112 E1462G probably damaging Het
Necab1 A G 4: 15,111,267 Y54H probably damaging Het
Nlrp4b A G 7: 10,718,593 K15R probably damaging Het
Ntrk1 A G 3: 87,789,630 S139P probably benign Het
Oas1d T C 5: 120,915,837 F120S probably damaging Het
Ofd1 A G X: 166,406,006 Y755H probably benign Het
Olfr118 A G 17: 37,672,663 I213M probably damaging Het
Olfr1317 T G 2: 112,142,720 Y258* probably null Het
Olfr1412 A G 1: 92,589,115 I262V probably benign Het
Olfr368 T A 2: 37,332,418 F224I probably benign Het
Olfr482 A C 7: 108,095,609 probably null Het
Olfr539 A G 7: 140,668,135 T276A probably benign Het
Plekha6 T C 1: 133,273,913 S355P probably benign Het
Prdm14 T C 1: 13,118,858 K421E probably damaging Het
Prss36 A G 7: 127,933,453 L731P probably damaging Het
Rad51d A G 11: 82,883,938 L97P probably damaging Het
Rbl1 C A 2: 157,163,534 probably null Het
Rnh1 G T 7: 141,164,606 A52D possibly damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Ryr2 A C 13: 11,745,176 probably null Het
Samd4 A T 14: 47,089,075 N454I probably damaging Het
Sap130 T C 18: 31,636,082 I32T probably benign Het
Sap30l A T 11: 57,806,099 N85I probably damaging Het
Sbf2 G A 7: 110,461,146 Q204* probably null Het
Slc45a3 T C 1: 131,976,956 W6R possibly damaging Het
Snx16 A G 3: 10,419,161 V334A probably damaging Het
Soat1 C T 1: 156,442,421 V143I probably benign Het
Sp8 T A 12: 118,849,567 F386I probably damaging Het
Spag6 C T 2: 18,734,117 S286L probably benign Het
Srpr A T 9: 35,212,851 N31I possibly damaging Het
Ssbp4 A G 8: 70,598,852 probably null Het
Stxbp2 G T 8: 3,634,064 A124S probably benign Het
Tacc2 A G 7: 130,742,240 K700R probably damaging Het
Tatdn2 A T 6: 113,702,099 probably null Het
Tecrl G A 5: 83,291,287 T226I probably damaging Het
Timeless T G 10: 128,247,608 V702G probably benign Het
Tjp1 A T 7: 65,313,005 S1061R probably benign Het
Tmem39b A T 4: 129,693,218 C67S probably damaging Het
Tstd3 T C 4: 21,759,475 Y99C probably damaging Het
Ttc39c T A 18: 12,684,824 probably null Het
Ttll7 C T 3: 146,894,405 P23S probably benign Het
Uba5 A G 9: 104,049,908 F290S probably damaging Het
Ubap2l T C 3: 90,019,231 Y623C probably damaging Het
Ube3a A G 7: 59,275,966 E164G probably damaging Het
Ugcg A G 4: 59,207,775 N38S probably benign Het
Ugp2 G A 11: 21,329,915 T283I probably damaging Het
Vmn1r55 A T 7: 5,146,920 I168N probably benign Het
Wdr27 A C 17: 14,892,441 S668A probably damaging Het
Wnt2 T A 6: 18,008,697 N247I probably damaging Het
Zfp850 A T 7: 27,985,275 C15* probably null Het
Zfp959 A G 17: 55,897,677 probably null Het
Other mutations in Dennd5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Dennd5a APN 7 109908372 missense probably benign
IGL01338:Dennd5a APN 7 109919404 missense possibly damaging 0.92
IGL01618:Dennd5a APN 7 109934095 missense probably damaging 1.00
IGL02047:Dennd5a APN 7 109934784 missense possibly damaging 0.92
IGL02277:Dennd5a APN 7 109897969 missense possibly damaging 0.61
IGL02492:Dennd5a APN 7 109933637 missense probably benign
IGL02697:Dennd5a APN 7 109894781 missense probably damaging 1.00
IGL02935:Dennd5a APN 7 109921307 missense possibly damaging 0.80
IGL02986:Dennd5a APN 7 109935524 missense probably benign
IGL03088:Dennd5a APN 7 109908381 missense probably damaging 1.00
IGL03156:Dennd5a APN 7 109919255 splice site probably benign
IGL03181:Dennd5a APN 7 109933658 missense probably damaging 1.00
big_pal UTSW 7 109919423 nonsense probably null
Celestial UTSW 7 109901089 missense probably damaging 1.00
R0055:Dennd5a UTSW 7 109899791 missense possibly damaging 0.72
R0055:Dennd5a UTSW 7 109899791 missense possibly damaging 0.72
R0092:Dennd5a UTSW 7 109899806 missense possibly damaging 0.95
R0111:Dennd5a UTSW 7 109934754 missense probably damaging 1.00
R0517:Dennd5a UTSW 7 109934761 missense probably damaging 1.00
R0546:Dennd5a UTSW 7 109921426 missense probably benign 0.01
R0811:Dennd5a UTSW 7 109933613 missense possibly damaging 0.93
R0812:Dennd5a UTSW 7 109933613 missense possibly damaging 0.93
R0827:Dennd5a UTSW 7 109899731 missense probably damaging 1.00
R0831:Dennd5a UTSW 7 109934754 missense probably damaging 1.00
R1075:Dennd5a UTSW 7 109918601 missense probably benign
R1115:Dennd5a UTSW 7 109918761 missense probably damaging 1.00
R1128:Dennd5a UTSW 7 109921334 nonsense probably null
R1300:Dennd5a UTSW 7 109919407 missense probably benign
R1698:Dennd5a UTSW 7 109917380 splice site probably null
R1711:Dennd5a UTSW 7 109918712 missense probably benign 0.00
R1803:Dennd5a UTSW 7 109898613 missense probably benign 0.00
R2064:Dennd5a UTSW 7 109898693 splice site probably benign
R2176:Dennd5a UTSW 7 109905120 intron probably null
R2182:Dennd5a UTSW 7 109933994 missense probably benign 0.03
R2852:Dennd5a UTSW 7 109933671 missense probably damaging 1.00
R2853:Dennd5a UTSW 7 109933671 missense probably damaging 1.00
R3035:Dennd5a UTSW 7 109921352 missense probably benign 0.00
R3835:Dennd5a UTSW 7 109934242 missense probably benign 0.00
R3953:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3954:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3955:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3957:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R4014:Dennd5a UTSW 7 109935481 critical splice donor site probably null
R4166:Dennd5a UTSW 7 109926825 critical splice donor site probably null
R4362:Dennd5a UTSW 7 109896343 missense probably damaging 1.00
R4567:Dennd5a UTSW 7 109899735 missense probably benign 0.06
R4700:Dennd5a UTSW 7 109921198 missense probably benign 0.01
R4734:Dennd5a UTSW 7 109896336 missense probably damaging 0.96
R4914:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4915:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4918:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4992:Dennd5a UTSW 7 109894712 missense probably damaging 0.98
R5011:Dennd5a UTSW 7 109914776 missense possibly damaging 0.89
R5013:Dennd5a UTSW 7 109914776 missense possibly damaging 0.89
R5034:Dennd5a UTSW 7 109899797 missense probably damaging 0.98
R5194:Dennd5a UTSW 7 109933729 missense probably damaging 1.00
R5359:Dennd5a UTSW 7 109897962 missense probably damaging 1.00
R5430:Dennd5a UTSW 7 109934240 missense probably damaging 1.00
R5586:Dennd5a UTSW 7 109905721 missense possibly damaging 0.72
R5607:Dennd5a UTSW 7 109919423 nonsense probably null
R5608:Dennd5a UTSW 7 109919423 nonsense probably null
R5783:Dennd5a UTSW 7 109894636 missense probably damaging 0.97
R5866:Dennd5a UTSW 7 109919360 missense probably benign 0.00
R5890:Dennd5a UTSW 7 109934221 missense probably benign 0.00
R6053:Dennd5a UTSW 7 109933745 missense probably damaging 1.00
R6247:Dennd5a UTSW 7 109898682 missense probably damaging 1.00
R6362:Dennd5a UTSW 7 109934265 nonsense probably null
R6446:Dennd5a UTSW 7 109894666 missense probably damaging 1.00
R6894:Dennd5a UTSW 7 109901118 missense probably damaging 1.00
Z1088:Dennd5a UTSW 7 109894747 missense possibly damaging 0.73
Z1088:Dennd5a UTSW 7 109905273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTCTTGCCTCAAAACCAGTTTCC -3'
(R):5'- CACTAGGCATCCTTCCTGTCAGATCAG -3'

Sequencing Primer
(F):5'- tggtaaggcagaggcgg -3'
(R):5'- TCCTGTCAGATCAGCCTGAG -3'
Posted On2014-05-23