Incidental Mutation 'R1772:Fbn1'
ID196659
Institutional Source Beutler Lab
Gene Symbol Fbn1
Ensembl Gene ENSMUSG00000027204
Gene Namefibrillin 1
SynonymsFib-1
MMRRC Submission 039803-MU
Accession Numbers

Genbank: NM_007993; MGI: 95489

Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock #R1772 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location125300594-125507993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125403228 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 246 (D246E)
Ref Sequence ENSEMBL: ENSMUSP00000099524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028633] [ENSMUST00000103234]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028633
AA Change: D246E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028633
Gene: ENSMUSG00000027204
AA Change: D246E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
EGF 118 146 8.52e0 SMART
EGF 149 178 5.4e-2 SMART
Pfam:TB 193 235 6.9e-17 PFAM
EGF_CA 246 287 3.56e-11 SMART
EGF_CA 288 329 9.39e-11 SMART
Pfam:TB 343 388 2.3e-17 PFAM
low complexity region 394 445 N/A INTRINSIC
EGF 454 491 8.57e-5 SMART
EGF_CA 492 531 9.39e-11 SMART
EGF_CA 532 573 2.38e-12 SMART
EGF_CA 574 614 5.48e-12 SMART
EGF_CA 615 655 5.39e-11 SMART
Pfam:TB 670 712 1.4e-17 PFAM
EGF_CA 725 766 1.53e-10 SMART
EGF_CA 767 808 2.42e-13 SMART
EGF_CA 809 848 2.44e-9 SMART
Pfam:TB 862 902 2.1e-14 PFAM
EGF_CA 912 953 3.32e-11 SMART
Pfam:TB 967 1009 3.9e-17 PFAM
EGF_CA 1030 1071 5.11e-12 SMART
EGF_CA 1072 1114 5.39e-11 SMART
EGF_CA 1115 1156 1.55e-11 SMART
EGF_CA 1157 1198 5.48e-12 SMART
EGF_CA 1199 1239 5.61e-9 SMART
EGF_CA 1240 1281 1.22e-9 SMART
EGF_CA 1282 1323 2.62e-9 SMART
EGF_CA 1324 1364 3.27e-10 SMART
EGF_CA 1365 1405 4.7e-11 SMART
EGF_CA 1406 1447 1.91e-11 SMART
EGF_CA 1448 1488 1.98e-9 SMART
EGF_CA 1489 1529 2.13e-9 SMART
Pfam:TB 1549 1590 3.5e-18 PFAM
EGF_CA 1608 1649 2.19e-11 SMART
EGF_CA 1650 1690 3.97e-9 SMART
Pfam:TB 1706 1749 9.7e-18 PFAM
EGF_CA 1768 1809 5.11e-12 SMART
EGF_CA 1810 1850 1.1e-11 SMART
EGF_CA 1851 1892 5.69e-10 SMART
EGF_CA 1893 1931 6.1e-10 SMART
EGF_CA 1932 1974 2.11e-13 SMART
EGF_CA 1975 2014 7.23e-12 SMART
EGF_CA 2015 2056 3.15e-12 SMART
Pfam:TB 2070 2112 3.7e-17 PFAM
EGF_CA 2129 2167 1.24e-10 SMART
EGF_CA 2168 2207 3.81e-11 SMART
EGF_CA 2208 2248 3.81e-11 SMART
EGF 2252 2292 5.24e0 SMART
EGF_CA 2293 2334 9.91e-10 SMART
Pfam:TB 2348 2391 8.5e-18 PFAM
EGF_CA 2404 2445 1.26e-11 SMART
EGF_CA 2446 2486 1.06e-9 SMART
EGF_CA 2487 2525 3.1e-11 SMART
EGF_CA 2526 2568 1.48e-8 SMART
EGF_CA 2569 2608 1.14e-9 SMART
EGF_CA 2609 2649 3.97e-9 SMART
EGF_CA 2650 2689 1.98e-9 SMART
low complexity region 2691 2698 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103234
AA Change: D246E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099524
Gene: ENSMUSG00000027204
AA Change: D246E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
EGF 118 146 8.52e0 SMART
EGF 149 178 5.4e-2 SMART
Pfam:TB 194 232 3.5e-10 PFAM
EGF_CA 246 287 3.56e-11 SMART
EGF_CA 288 329 9.39e-11 SMART
Pfam:TB 344 388 6.8e-15 PFAM
low complexity region 394 445 N/A INTRINSIC
EGF 454 491 8.57e-5 SMART
EGF_CA 492 531 9.39e-11 SMART
EGF_CA 532 573 2.38e-12 SMART
EGF_CA 574 614 5.48e-12 SMART
EGF_CA 615 655 5.39e-11 SMART
Pfam:TB 671 712 8.3e-16 PFAM
EGF_CA 725 766 1.53e-10 SMART
EGF_CA 767 808 2.42e-13 SMART
EGF_CA 809 848 2.44e-9 SMART
Pfam:TB 863 898 3.1e-8 PFAM
EGF_CA 912 953 3.32e-11 SMART
Pfam:TB 968 1009 1.5e-15 PFAM
EGF_CA 1030 1071 5.11e-12 SMART
EGF_CA 1072 1114 5.39e-11 SMART
EGF_CA 1115 1156 1.55e-11 SMART
EGF_CA 1157 1198 5.48e-12 SMART
EGF_CA 1199 1239 5.61e-9 SMART
EGF_CA 1240 1281 1.22e-9 SMART
EGF_CA 1282 1323 2.62e-9 SMART
EGF_CA 1324 1364 3.27e-10 SMART
EGF_CA 1365 1405 4.7e-11 SMART
EGF_CA 1406 1447 1.91e-11 SMART
EGF_CA 1448 1488 1.98e-9 SMART
EGF_CA 1489 1529 2.13e-9 SMART
Pfam:TB 1550 1590 5.3e-17 PFAM
EGF_CA 1608 1649 2.19e-11 SMART
EGF_CA 1650 1690 3.97e-9 SMART
Pfam:TB 1707 1749 1.6e-16 PFAM
EGF_CA 1768 1809 5.11e-12 SMART
EGF_CA 1810 1850 1.1e-11 SMART
EGF_CA 1851 1892 5.69e-10 SMART
EGF_CA 1893 1931 6.1e-10 SMART
EGF_CA 1932 1974 2.11e-13 SMART
EGF_CA 1975 2014 7.23e-12 SMART
EGF_CA 2015 2056 3.15e-12 SMART
Pfam:TB 2071 2112 1.9e-15 PFAM
EGF_CA 2129 2167 1.24e-10 SMART
EGF_CA 2168 2207 3.81e-11 SMART
EGF_CA 2208 2248 3.81e-11 SMART
EGF 2252 2292 5.24e0 SMART
EGF_CA 2293 2334 9.91e-10 SMART
Pfam:TB 2349 2391 5.8e-15 PFAM
EGF_CA 2404 2445 1.26e-11 SMART
EGF_CA 2446 2486 1.06e-9 SMART
EGF_CA 2487 2525 3.1e-11 SMART
EGF_CA 2526 2568 1.48e-8 SMART
EGF_CA 2569 2608 1.14e-9 SMART
EGF_CA 2609 2649 3.97e-9 SMART
EGF_CA 2650 2689 1.98e-9 SMART
low complexity region 2691 2698 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148272
Meta Mutation Damage Score 0.252 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.5%
Validation Efficiency 97% (107/110)
MGI Phenotype Strain: 1934905; 4880665
Lethality: D7-D10
FUNCTION: This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Homozygous knockout mice for this gene exhibit impaired aortic development and early postnatal death, which was attributed to a deficiency in the fibrillin-1 protein. Mice with a hypomorphic allele of this gene exhibit impaired glucose homeostasis, likely due to a reduction in serum asprosin levels. [provided by RefSeq, Apr 2016]
PHENOTYPE: Lethality among homozygotes for spontaneous and targeted mutations ranges from embryonic death to death around 4 months. Abnormalities include vascular defects, excess bone growth, connective tissue hyperplasia, and lung emphysema. Mice heterozygous for a knock-in allele exhibit scleroderma. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(9) Spontaneous(1)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,432 S1937P probably damaging Het
Adgb G T 10: 10,382,721 probably benign Het
Aldh1a7 T C 19: 20,716,019 K179E probably damaging Het
Angptl7 G A 4: 148,497,426 R168C probably damaging Het
Atp8b1 T A 18: 64,573,492 I208F possibly damaging Het
Bco1 A G 8: 117,130,608 Y438C probably benign Het
Btrc A C 19: 45,512,661 K218Q probably damaging Het
Cct8l1 G A 5: 25,517,699 V471M probably damaging Het
Cd180 C T 13: 102,706,242 L599F probably benign Het
Cd300e T C 11: 115,054,518 N150S probably benign Het
Clcn1 C A 6: 42,294,145 T281K probably damaging Het
Cnnm3 T C 1: 36,518,957 S417P probably damaging Het
Cspg4 T A 9: 56,897,492 S1862R probably benign Het
Cspg5 A T 9: 110,262,138 N432Y probably damaging Het
Cyp2r1 T A 7: 114,553,216 I169F probably damaging Het
D130043K22Rik T A 13: 24,875,999 S618T probably damaging Het
Diaph3 G A 14: 86,965,549 P635L probably damaging Het
Dlg1 A G 16: 31,665,667 I38V possibly damaging Het
Dlk1 T G 12: 109,459,759 V186G probably damaging Het
Dmxl2 T C 9: 54,423,224 probably benign Het
Dnajc17 G A 2: 119,183,683 R132* probably null Het
Dock9 G T 14: 121,609,798 N1042K probably benign Het
Dok7 A T 5: 35,086,650 Q511L probably damaging Het
Espnl G A 1: 91,344,603 E562K possibly damaging Het
Evi5 G A 5: 107,795,841 T562I probably benign Het
Exd2 T A 12: 80,489,479 D294E probably benign Het
Fbxw16 A T 9: 109,439,582 W247R possibly damaging Het
Fcer1a A G 1: 173,225,437 I64T probably benign Het
Fcgbp C A 7: 28,105,175 Q1903K possibly damaging Het
Fmn1 A G 2: 113,365,355 S467G unknown Het
Fndc7 T A 3: 108,870,534 T369S probably damaging Het
Fnta T C 8: 26,000,966 probably benign Het
Gak A T 5: 108,606,892 H289Q probably damaging Het
Gas2l3 A G 10: 89,417,014 probably benign Het
Gbp8 T C 5: 105,016,121 N437S probably benign Het
Gk5 G A 9: 96,150,797 probably null Het
Gm21818 T A 13: 120,173,189 D2E probably benign Het
Hid1 A T 11: 115,348,473 V788E probably damaging Het
Hmcn1 T C 1: 150,563,568 T5505A probably damaging Het
Igf1r T A 7: 68,195,074 M865K probably benign Het
Katnal2 G A 18: 77,002,537 T258I probably damaging Het
Kdm3b A T 18: 34,803,504 I280L probably benign Het
Kif24 A G 4: 41,409,787 V382A probably damaging Het
Kif2a A T 13: 106,978,132 probably benign Het
Klhl10 A G 11: 100,442,196 I56V probably benign Het
Klk6 C T 7: 43,829,271 Q201* probably null Het
Klra3 A T 6: 130,323,708 S233T probably benign Het
Krt9 A T 11: 100,191,305 M223K probably damaging Het
Lama4 G A 10: 39,060,224 E632K probably benign Het
Lamb1 T C 12: 31,278,525 Y163H probably damaging Het
Lipo1 A G 19: 33,787,421 I11T probably benign Het
Lix1l T A 3: 96,623,891 H333Q possibly damaging Het
Mal2 T A 15: 54,588,387 M68K probably damaging Het
Map2k2 T C 10: 81,121,100 I104T probably damaging Het
Matn2 T C 15: 34,428,785 V765A probably damaging Het
Mptx2 T A 1: 173,274,473 K216N probably damaging Het
Mup5 C T 4: 61,832,341 probably null Het
Mycbp2 A G 14: 103,182,419 Y2494H probably damaging Het
Myh3 G A 11: 67,099,394 D1622N probably benign Het
Myo6 T C 9: 80,270,049 I609T possibly damaging Het
Ndst1 G A 18: 60,702,837 T458I probably damaging Het
Neb A T 2: 52,235,677 Y3622N probably damaging Het
Ntm A G 9: 29,179,100 Y108H probably benign Het
Olfr273 T G 4: 52,855,730 K261T probably benign Het
Olfr43 T C 11: 74,206,572 I215V probably benign Het
Olfr596 T C 7: 103,310,242 Y174H possibly damaging Het
Pappa2 T A 1: 158,814,368 I1373F possibly damaging Het
Pear1 A G 3: 87,754,492 probably benign Het
Phc3 C T 3: 30,961,820 A81T probably damaging Het
Pmepa1 A G 2: 173,234,360 S105P probably damaging Het
Ppp6r1 T C 7: 4,642,031 I248V probably benign Het
Prdm4 G A 10: 85,893,392 T717I probably damaging Het
Prom1 T C 5: 44,011,224 T669A probably benign Het
Ptpn5 T A 7: 47,090,768 I96F probably benign Het
Ptpro T C 6: 137,430,743 L922P probably damaging Het
Reck A T 4: 43,890,982 H40L probably benign Het
Rreb1 T A 13: 37,930,923 C753S probably benign Het
Sacs T C 14: 61,210,897 L3464P probably damaging Het
Samsn1 A T 16: 75,870,775 D304E probably benign Het
Scgb2b3 T C 7: 31,360,196 N51S possibly damaging Het
Shroom3 T C 5: 92,940,656 S341P probably damaging Het
Siglece T C 7: 43,659,293 D212G probably damaging Het
Sirpa A G 2: 129,616,456 T331A probably damaging Het
Spata21 T C 4: 141,111,296 S553P possibly damaging Het
Speer4b T A 5: 27,500,238 probably benign Het
Srgap2 T C 1: 131,319,638 D552G probably damaging Het
Stab2 A G 10: 86,954,234 I556T probably benign Het
Strip1 C T 3: 107,626,731 probably null Het
Stxbp6 T A 12: 44,902,870 D92V probably damaging Het
Styx A G 14: 45,356,758 K46E probably damaging Het
Supt20 T A 3: 54,710,420 V314E probably damaging Het
Syne2 T A 12: 75,938,729 D1650E probably benign Het
Szt2 T A 4: 118,405,517 K21M probably damaging Het
Tbx4 A T 11: 85,911,207 H222L probably damaging Het
Tmx3 A T 18: 90,532,997 I254L probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpv2 A T 11: 62,594,226 probably benign Het
Ubap2 A G 4: 41,202,380 S683P probably benign Het
Ube2d3 C T 3: 135,465,211 R139W probably benign Het
Ubox5 G T 2: 130,591,874 Q518K probably benign Het
Usp42 T C 5: 143,717,102 N588S probably damaging Het
Vars2 G A 17: 35,660,084 T618M probably damaging Het
Wfdc17 A T 11: 83,704,904 N65Y probably damaging Het
Zbtb38 G A 9: 96,688,041 P330L probably damaging Het
Zfp385a C T 15: 103,315,881 probably null Het
Zfp637 T A 6: 117,845,412 L167H probably damaging Het
Other mutations in Fbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Fbn1 APN 2 125324947 missense probably damaging 1.00
IGL00159:Fbn1 APN 2 125397873 missense probably benign 0.14
IGL00500:Fbn1 APN 2 125317516 missense probably damaging 0.99
IGL00558:Fbn1 APN 2 125329128 splice site probably benign
IGL00645:Fbn1 APN 2 125317103 splice site probably benign
IGL00863:Fbn1 APN 2 125403219 missense possibly damaging 0.84
IGL00926:Fbn1 APN 2 125319042 missense possibly damaging 0.84
IGL00935:Fbn1 APN 2 125377910 nonsense probably null
IGL00950:Fbn1 APN 2 125358823 missense probably damaging 1.00
IGL01090:Fbn1 APN 2 125394776 splice site probably benign
IGL01106:Fbn1 APN 2 125351706 missense possibly damaging 0.55
IGL01486:Fbn1 APN 2 125389978 missense probably benign 0.03
IGL01519:Fbn1 APN 2 125317019 missense probably benign 0.07
IGL01585:Fbn1 APN 2 125360110 missense probably damaging 0.98
IGL01730:Fbn1 APN 2 125312974 splice site probably benign
IGL01793:Fbn1 APN 2 125387293 missense possibly damaging 0.67
IGL01803:Fbn1 APN 2 125350287 missense probably damaging 1.00
IGL01803:Fbn1 APN 2 125301725 missense probably benign
IGL01916:Fbn1 APN 2 125315446 missense possibly damaging 0.55
IGL02035:Fbn1 APN 2 125335362 splice site probably null
IGL02097:Fbn1 APN 2 125363969 missense probably damaging 1.00
IGL02233:Fbn1 APN 2 125321610 splice site probably benign
IGL02512:Fbn1 APN 2 125338460 missense probably damaging 1.00
IGL02552:Fbn1 APN 2 125412713 missense possibly damaging 0.86
IGL02657:Fbn1 APN 2 125352025 missense possibly damaging 0.86
IGL02718:Fbn1 APN 2 125369886 missense probably damaging 1.00
IGL02863:Fbn1 APN 2 125303256 missense possibly damaging 0.80
IGL02974:Fbn1 APN 2 125346330 missense probably null 0.99
IGL03058:Fbn1 APN 2 125403200 missense probably benign 0.03
IGL03172:Fbn1 APN 2 125320968 missense possibly damaging 0.92
IGL03288:Fbn1 APN 2 125303183 missense probably benign 0.13
carinatum UTSW 2 125342830 missense possibly damaging 0.70
lincoln UTSW 2 125403170 missense possibly damaging 0.50
reaper UTSW 2 125315404 missense probably damaging 0.98
scythe UTSW 2 125403228 missense possibly damaging 0.84
string_bean UTSW 2 125379134 splice site probably null
wirey UTSW 2 125309495 missense probably benign
3-1:Fbn1 UTSW 2 125394605 splice site probably benign
P0012:Fbn1 UTSW 2 125369321 splice site probably benign
PIT4403001:Fbn1 UTSW 2 125342911 missense probably damaging 1.00
PIT4466001:Fbn1 UTSW 2 125306501 missense possibly damaging 0.90
PIT4472001:Fbn1 UTSW 2 125306501 missense possibly damaging 0.90
PIT4651001:Fbn1 UTSW 2 125363989 critical splice acceptor site probably null
R0226:Fbn1 UTSW 2 125320910 missense possibly damaging 0.86
R0310:Fbn1 UTSW 2 125363644 missense probably damaging 1.00
R0362:Fbn1 UTSW 2 125309777 missense probably damaging 0.99
R0374:Fbn1 UTSW 2 125321676 missense possibly damaging 0.86
R0433:Fbn1 UTSW 2 125348215 missense possibly damaging 0.95
R0441:Fbn1 UTSW 2 125309755 critical splice donor site probably null
R0501:Fbn1 UTSW 2 125301749 missense probably benign 0.23
R0510:Fbn1 UTSW 2 125342925 splice site probably benign
R0573:Fbn1 UTSW 2 125389249 missense probably damaging 0.99
R0622:Fbn1 UTSW 2 125379024 missense possibly damaging 0.88
R0630:Fbn1 UTSW 2 125394770 missense possibly damaging 0.48
R0724:Fbn1 UTSW 2 125352064 missense probably benign 0.14
R0739:Fbn1 UTSW 2 125367630 missense probably benign 0.18
R0744:Fbn1 UTSW 2 125314814 splice site probably benign
R0811:Fbn1 UTSW 2 125403170 missense possibly damaging 0.50
R0812:Fbn1 UTSW 2 125403170 missense possibly damaging 0.50
R0862:Fbn1 UTSW 2 125342891 nonsense probably null
R0864:Fbn1 UTSW 2 125342891 nonsense probably null
R1061:Fbn1 UTSW 2 125345963 missense probably benign 0.01
R1126:Fbn1 UTSW 2 125321192 splice site probably null
R1172:Fbn1 UTSW 2 125394687 missense probably benign 0.13
R1175:Fbn1 UTSW 2 125394687 missense probably benign 0.13
R1183:Fbn1 UTSW 2 125321617 missense probably benign 0.07
R1218:Fbn1 UTSW 2 125412749 missense possibly damaging 0.71
R1241:Fbn1 UTSW 2 125372527 splice site probably benign
R1248:Fbn1 UTSW 2 125301609 missense probably benign 0.01
R1345:Fbn1 UTSW 2 125314671 missense probably damaging 1.00
R1374:Fbn1 UTSW 2 125346434 missense probably damaging 0.99
R1458:Fbn1 UTSW 2 125301929 missense probably benign 0.01
R1474:Fbn1 UTSW 2 125361265 missense possibly damaging 0.72
R1496:Fbn1 UTSW 2 125309495 missense probably benign
R1502:Fbn1 UTSW 2 125363706 nonsense probably null
R1511:Fbn1 UTSW 2 125306285 missense probably benign 0.00
R1588:Fbn1 UTSW 2 125319114 missense probably benign 0.19
R1626:Fbn1 UTSW 2 125341279 missense probably damaging 1.00
R1676:Fbn1 UTSW 2 125309781 missense probably damaging 1.00
R1712:Fbn1 UTSW 2 125346434 missense probably damaging 0.99
R1776:Fbn1 UTSW 2 125321734 missense possibly damaging 0.71
R1869:Fbn1 UTSW 2 125352027 missense probably benign 0.00
R1894:Fbn1 UTSW 2 125394621 missense probably damaging 0.96
R1925:Fbn1 UTSW 2 125363629 missense probably damaging 1.00
R1957:Fbn1 UTSW 2 125367654 missense possibly damaging 0.93
R1995:Fbn1 UTSW 2 125350373 critical splice acceptor site probably null
R2140:Fbn1 UTSW 2 125343810 missense probably damaging 1.00
R2142:Fbn1 UTSW 2 125412708 missense possibly damaging 0.93
R2268:Fbn1 UTSW 2 125321741 missense possibly damaging 0.49
R3409:Fbn1 UTSW 2 125412665 missense possibly damaging 0.92
R3418:Fbn1 UTSW 2 125320926 missense possibly damaging 0.55
R3508:Fbn1 UTSW 2 125306327 missense probably benign 0.19
R3778:Fbn1 UTSW 2 125317086 missense probably damaging 1.00
R3800:Fbn1 UTSW 2 125345974 missense possibly damaging 0.63
R4001:Fbn1 UTSW 2 125477495 critical splice donor site probably null
R4169:Fbn1 UTSW 2 125363952 missense possibly damaging 0.86
R4398:Fbn1 UTSW 2 125397781 missense probably benign 0.32
R4482:Fbn1 UTSW 2 125363610 critical splice donor site probably null
R4559:Fbn1 UTSW 2 125351714 missense possibly damaging 0.65
R4608:Fbn1 UTSW 2 125306500 missense probably benign 0.05
R4634:Fbn1 UTSW 2 125344061 missense probably damaging 1.00
R4706:Fbn1 UTSW 2 125370149 missense probably benign 0.21
R4712:Fbn1 UTSW 2 125341316 missense probably benign 0.12
R4783:Fbn1 UTSW 2 125324919 missense probably damaging 1.00
R4784:Fbn1 UTSW 2 125324919 missense probably damaging 1.00
R4785:Fbn1 UTSW 2 125324919 missense probably damaging 1.00
R4793:Fbn1 UTSW 2 125321235 nonsense probably null
R4838:Fbn1 UTSW 2 125372399 missense probably benign 0.01
R4864:Fbn1 UTSW 2 125372397 missense possibly damaging 0.92
R4887:Fbn1 UTSW 2 125309774 missense probably damaging 1.00
R4942:Fbn1 UTSW 2 125383616 missense possibly damaging 0.88
R4952:Fbn1 UTSW 2 125317534 missense probably damaging 1.00
R5030:Fbn1 UTSW 2 125412704 missense possibly damaging 0.51
R5044:Fbn1 UTSW 2 125329102 missense probably damaging 0.97
R5057:Fbn1 UTSW 2 125466695 missense probably benign 0.33
R5115:Fbn1 UTSW 2 125332383 missense probably damaging 1.00
R5399:Fbn1 UTSW 2 125332333 missense possibly damaging 0.69
R5498:Fbn1 UTSW 2 125360176 missense probably damaging 1.00
R5526:Fbn1 UTSW 2 125365639 missense possibly damaging 0.83
R5529:Fbn1 UTSW 2 125373950 missense probably benign 0.01
R5602:Fbn1 UTSW 2 125321741 missense possibly damaging 0.49
R5760:Fbn1 UTSW 2 125361247 missense probably damaging 1.00
R5837:Fbn1 UTSW 2 125379134 splice site probably null
R5955:Fbn1 UTSW 2 125358882 missense probably damaging 1.00
R5980:Fbn1 UTSW 2 125315404 missense probably damaging 0.98
R6039:Fbn1 UTSW 2 125363880 missense probably damaging 1.00
R6039:Fbn1 UTSW 2 125363880 missense probably damaging 1.00
R6058:Fbn1 UTSW 2 125466612 missense possibly damaging 0.73
R6089:Fbn1 UTSW 2 125321225 missense possibly damaging 0.55
R6136:Fbn1 UTSW 2 125403132 missense possibly damaging 0.63
R6161:Fbn1 UTSW 2 125369801 nonsense probably null
R6162:Fbn1 UTSW 2 125360227 missense probably damaging 1.00
R6165:Fbn1 UTSW 2 125332363 missense probably damaging 0.99
R6169:Fbn1 UTSW 2 125335489 critical splice acceptor site probably null
R6221:Fbn1 UTSW 2 125320921 missense probably benign 0.07
R6223:Fbn1 UTSW 2 125412671 missense possibly damaging 0.86
R6225:Fbn1 UTSW 2 125330543 missense probably damaging 1.00
R6238:Fbn1 UTSW 2 125324945 missense probably damaging 0.98
R6329:Fbn1 UTSW 2 125308473 missense possibly damaging 0.70
R6401:Fbn1 UTSW 2 125346450 missense probably damaging 0.98
R6480:Fbn1 UTSW 2 125335418 missense probably benign 0.05
R6513:Fbn1 UTSW 2 125383671 missense probably damaging 1.00
R6530:Fbn1 UTSW 2 125389270 missense probably damaging 0.99
R6595:Fbn1 UTSW 2 125342830 missense possibly damaging 0.70
R6781:Fbn1 UTSW 2 125317038 missense probably damaging 1.00
R6849:Fbn1 UTSW 2 125321691 missense possibly damaging 0.82
R6860:Fbn1 UTSW 2 125328158 missense probably damaging 1.00
R6960:Fbn1 UTSW 2 125382060 missense probably benign 0.16
R7134:Fbn1 UTSW 2 125382049 missense probably benign 0.03
R7241:Fbn1 UTSW 2 125306495 missense possibly damaging 0.86
R7295:Fbn1 UTSW 2 125335487 missense probably damaging 1.00
R7312:Fbn1 UTSW 2 125466674 missense possibly damaging 0.53
R7322:Fbn1 UTSW 2 125479195 missense possibly damaging 0.92
R7349:Fbn1 UTSW 2 125315401 missense possibly damaging 0.84
R7365:Fbn1 UTSW 2 125352049 missense probably damaging 0.97
R7392:Fbn1 UTSW 2 125343924 missense probably damaging 1.00
X0019:Fbn1 UTSW 2 125383643 missense possibly damaging 0.82
X0020:Fbn1 UTSW 2 125369340 missense probably damaging 1.00
X0028:Fbn1 UTSW 2 125342798 critical splice donor site probably null
X0067:Fbn1 UTSW 2 125369914 missense possibly damaging 0.95
Z1088:Fbn1 UTSW 2 125350288 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGCAAACCATGAGGTTGCTTAC -3'
(R):5'- GGCCCTGATGAACTTTTCCTGCAC -3'

Sequencing Primer
(F):5'- ACCATGAGGTTGCTTACCTTCAC -3'
(R):5'- TGTGTATGATGAAGCCCCAC -3'
Posted On2014-05-23