Incidental Mutation 'R1772:Ubap2'
ID196672
Institutional Source Beutler Lab
Gene Symbol Ubap2
Ensembl Gene ENSMUSG00000028433
Gene Nameubiquitin-associated protein 2
Synonyms1190005K07Rik
MMRRC Submission 039803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R1772 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41194313-41275144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41202380 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 683 (S683P)
Ref Sequence ENSEMBL: ENSMUSP00000103703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030143] [ENSMUST00000108068] [ENSMUST00000135323]
Predicted Effect probably benign
Transcript: ENSMUST00000030143
AA Change: S684P

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000030143
Gene: ENSMUSG00000028433
AA Change: S684P

DomainStartEndE-ValueType
UBA 53 91 9.62e-8 SMART
low complexity region 115 127 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
low complexity region 166 185 N/A INTRINSIC
low complexity region 256 266 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
Pfam:DUF3697 512 544 1.5e-18 PFAM
low complexity region 583 618 N/A INTRINSIC
low complexity region 631 644 N/A INTRINSIC
low complexity region 696 722 N/A INTRINSIC
low complexity region 744 768 N/A INTRINSIC
low complexity region 787 800 N/A INTRINSIC
low complexity region 888 914 N/A INTRINSIC
low complexity region 1007 1024 N/A INTRINSIC
low complexity region 1057 1078 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
low complexity region 1101 1115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108068
AA Change: S683P

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103703
Gene: ENSMUSG00000028433
AA Change: S683P

DomainStartEndE-ValueType
UBA 52 90 9.62e-8 SMART
low complexity region 114 126 N/A INTRINSIC
low complexity region 129 143 N/A INTRINSIC
low complexity region 165 184 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
low complexity region 435 447 N/A INTRINSIC
Pfam:DUF3697 511 543 1.2e-20 PFAM
low complexity region 582 617 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 695 721 N/A INTRINSIC
low complexity region 743 767 N/A INTRINSIC
low complexity region 786 799 N/A INTRINSIC
low complexity region 887 913 N/A INTRINSIC
low complexity region 1006 1023 N/A INTRINSIC
low complexity region 1056 1077 N/A INTRINSIC
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135323
SMART Domains Protein: ENSMUSP00000122256
Gene: ENSMUSG00000028433

DomainStartEndE-ValueType
low complexity region 74 91 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158640
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.5%
Validation Efficiency 97% (107/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBA (ubiquitin associated) domain, which is characteristic of proteins that function in the ubiquitination pathway. This gene may show increased expression in the adrenal gland and lymphatic tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,432 S1937P probably damaging Het
Adgb G T 10: 10,382,721 probably benign Het
Aldh1a7 T C 19: 20,716,019 K179E probably damaging Het
Angptl7 G A 4: 148,497,426 R168C probably damaging Het
Atp8b1 T A 18: 64,573,492 I208F possibly damaging Het
Bco1 A G 8: 117,130,608 Y438C probably benign Het
Btrc A C 19: 45,512,661 K218Q probably damaging Het
Cct8l1 G A 5: 25,517,699 V471M probably damaging Het
Cd180 C T 13: 102,706,242 L599F probably benign Het
Cd300e T C 11: 115,054,518 N150S probably benign Het
Clcn1 C A 6: 42,294,145 T281K probably damaging Het
Cnnm3 T C 1: 36,518,957 S417P probably damaging Het
Cspg4 T A 9: 56,897,492 S1862R probably benign Het
Cspg5 A T 9: 110,262,138 N432Y probably damaging Het
Cyp2r1 T A 7: 114,553,216 I169F probably damaging Het
D130043K22Rik T A 13: 24,875,999 S618T probably damaging Het
Diaph3 G A 14: 86,965,549 P635L probably damaging Het
Dlg1 A G 16: 31,665,667 I38V possibly damaging Het
Dlk1 T G 12: 109,459,759 V186G probably damaging Het
Dmxl2 T C 9: 54,423,224 probably benign Het
Dnajc17 G A 2: 119,183,683 R132* probably null Het
Dock9 G T 14: 121,609,798 N1042K probably benign Het
Dok7 A T 5: 35,086,650 Q511L probably damaging Het
Espnl G A 1: 91,344,603 E562K possibly damaging Het
Evi5 G A 5: 107,795,841 T562I probably benign Het
Exd2 T A 12: 80,489,479 D294E probably benign Het
Fbn1 A T 2: 125,403,228 D246E possibly damaging Het
Fbxw16 A T 9: 109,439,582 W247R possibly damaging Het
Fcer1a A G 1: 173,225,437 I64T probably benign Het
Fcgbp C A 7: 28,105,175 Q1903K possibly damaging Het
Fmn1 A G 2: 113,365,355 S467G unknown Het
Fndc7 T A 3: 108,870,534 T369S probably damaging Het
Fnta T C 8: 26,000,966 probably benign Het
Gak A T 5: 108,606,892 H289Q probably damaging Het
Gas2l3 A G 10: 89,417,014 probably benign Het
Gbp8 T C 5: 105,016,121 N437S probably benign Het
Gk5 G A 9: 96,150,797 probably null Het
Gm21818 T A 13: 120,173,189 D2E probably benign Het
Hid1 A T 11: 115,348,473 V788E probably damaging Het
Hmcn1 T C 1: 150,563,568 T5505A probably damaging Het
Igf1r T A 7: 68,195,074 M865K probably benign Het
Katnal2 G A 18: 77,002,537 T258I probably damaging Het
Kdm3b A T 18: 34,803,504 I280L probably benign Het
Kif24 A G 4: 41,409,787 V382A probably damaging Het
Kif2a A T 13: 106,978,132 probably benign Het
Klhl10 A G 11: 100,442,196 I56V probably benign Het
Klk6 C T 7: 43,829,271 Q201* probably null Het
Klra3 A T 6: 130,323,708 S233T probably benign Het
Krt9 A T 11: 100,191,305 M223K probably damaging Het
Lama4 G A 10: 39,060,224 E632K probably benign Het
Lamb1 T C 12: 31,278,525 Y163H probably damaging Het
Lipo1 A G 19: 33,787,421 I11T probably benign Het
Lix1l T A 3: 96,623,891 H333Q possibly damaging Het
Mal2 T A 15: 54,588,387 M68K probably damaging Het
Map2k2 T C 10: 81,121,100 I104T probably damaging Het
Matn2 T C 15: 34,428,785 V765A probably damaging Het
Mptx2 T A 1: 173,274,473 K216N probably damaging Het
Mup5 C T 4: 61,832,341 probably null Het
Mycbp2 A G 14: 103,182,419 Y2494H probably damaging Het
Myh3 G A 11: 67,099,394 D1622N probably benign Het
Myo6 T C 9: 80,270,049 I609T possibly damaging Het
Ndst1 G A 18: 60,702,837 T458I probably damaging Het
Neb A T 2: 52,235,677 Y3622N probably damaging Het
Ntm A G 9: 29,179,100 Y108H probably benign Het
Olfr273 T G 4: 52,855,730 K261T probably benign Het
Olfr43 T C 11: 74,206,572 I215V probably benign Het
Olfr596 T C 7: 103,310,242 Y174H possibly damaging Het
Pappa2 T A 1: 158,814,368 I1373F possibly damaging Het
Pear1 A G 3: 87,754,492 probably benign Het
Phc3 C T 3: 30,961,820 A81T probably damaging Het
Pmepa1 A G 2: 173,234,360 S105P probably damaging Het
Ppp6r1 T C 7: 4,642,031 I248V probably benign Het
Prdm4 G A 10: 85,893,392 T717I probably damaging Het
Prom1 T C 5: 44,011,224 T669A probably benign Het
Ptpn5 T A 7: 47,090,768 I96F probably benign Het
Ptpro T C 6: 137,430,743 L922P probably damaging Het
Reck A T 4: 43,890,982 H40L probably benign Het
Rreb1 T A 13: 37,930,923 C753S probably benign Het
Sacs T C 14: 61,210,897 L3464P probably damaging Het
Samsn1 A T 16: 75,870,775 D304E probably benign Het
Scgb2b3 T C 7: 31,360,196 N51S possibly damaging Het
Shroom3 T C 5: 92,940,656 S341P probably damaging Het
Siglece T C 7: 43,659,293 D212G probably damaging Het
Sirpa A G 2: 129,616,456 T331A probably damaging Het
Spata21 T C 4: 141,111,296 S553P possibly damaging Het
Speer4b T A 5: 27,500,238 probably benign Het
Srgap2 T C 1: 131,319,638 D552G probably damaging Het
Stab2 A G 10: 86,954,234 I556T probably benign Het
Strip1 C T 3: 107,626,731 probably null Het
Stxbp6 T A 12: 44,902,870 D92V probably damaging Het
Styx A G 14: 45,356,758 K46E probably damaging Het
Supt20 T A 3: 54,710,420 V314E probably damaging Het
Syne2 T A 12: 75,938,729 D1650E probably benign Het
Szt2 T A 4: 118,405,517 K21M probably damaging Het
Tbx4 A T 11: 85,911,207 H222L probably damaging Het
Tmx3 A T 18: 90,532,997 I254L probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpv2 A T 11: 62,594,226 probably benign Het
Ube2d3 C T 3: 135,465,211 R139W probably benign Het
Ubox5 G T 2: 130,591,874 Q518K probably benign Het
Usp42 T C 5: 143,717,102 N588S probably damaging Het
Vars2 G A 17: 35,660,084 T618M probably damaging Het
Wfdc17 A T 11: 83,704,904 N65Y probably damaging Het
Zbtb38 G A 9: 96,688,041 P330L probably damaging Het
Zfp385a C T 15: 103,315,881 probably null Het
Zfp637 T A 6: 117,845,412 L167H probably damaging Het
Other mutations in Ubap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Ubap2 APN 4 41195328 splice site probably benign
IGL01109:Ubap2 APN 4 41195155 missense probably damaging 1.00
IGL01354:Ubap2 APN 4 41207005 missense probably damaging 1.00
IGL01563:Ubap2 APN 4 41195998 missense probably damaging 0.96
IGL01602:Ubap2 APN 4 41227237 missense probably damaging 1.00
IGL01605:Ubap2 APN 4 41227237 missense probably damaging 1.00
IGL01688:Ubap2 APN 4 41226308 missense probably benign
IGL01733:Ubap2 APN 4 41195862 unclassified probably benign
IGL01896:Ubap2 APN 4 41202362 missense possibly damaging 0.85
IGL01942:Ubap2 APN 4 41251608 missense probably benign 0.00
IGL02095:Ubap2 APN 4 41229709 missense probably benign
R0608:Ubap2 UTSW 4 41218319 missense probably benign 0.10
R0938:Ubap2 UTSW 4 41202304 missense probably damaging 1.00
R1449:Ubap2 UTSW 4 41209351 critical splice donor site probably null
R1484:Ubap2 UTSW 4 41235593 missense probably damaging 1.00
R1548:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1549:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1604:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1607:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1739:Ubap2 UTSW 4 41206849 missense probably benign 0.00
R1862:Ubap2 UTSW 4 41221607 missense probably benign
R1869:Ubap2 UTSW 4 41233617 missense probably damaging 1.00
R1886:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1887:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2063:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2064:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2065:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2066:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2095:Ubap2 UTSW 4 41206901 missense possibly damaging 0.68
R2214:Ubap2 UTSW 4 41199714 critical splice donor site probably null
R2215:Ubap2 UTSW 4 41196483 unclassified probably null
R2318:Ubap2 UTSW 4 41251542 missense probably damaging 0.99
R3755:Ubap2 UTSW 4 41195482 missense probably damaging 1.00
R4620:Ubap2 UTSW 4 41233698 missense probably damaging 1.00
R4717:Ubap2 UTSW 4 41218333 missense possibly damaging 0.93
R4756:Ubap2 UTSW 4 41211771 missense probably damaging 1.00
R4942:Ubap2 UTSW 4 41245461 intron probably benign
R5344:Ubap2 UTSW 4 41251578 missense possibly damaging 0.46
R5763:Ubap2 UTSW 4 41195809 missense probably damaging 1.00
R5851:Ubap2 UTSW 4 41206268 nonsense probably null
R5951:Ubap2 UTSW 4 41205753 unclassified probably null
R6178:Ubap2 UTSW 4 41206981 missense probably benign
R6489:Ubap2 UTSW 4 41203574 critical splice acceptor site probably null
R6520:Ubap2 UTSW 4 41195155 missense probably damaging 1.00
R6652:Ubap2 UTSW 4 41196743 missense possibly damaging 0.68
R6702:Ubap2 UTSW 4 41227210 small insertion probably benign
R6736:Ubap2 UTSW 4 41227210 small insertion probably benign
R6736:Ubap2 UTSW 4 41227224 small insertion probably benign
R6860:Ubap2 UTSW 4 41233631 missense probably damaging 1.00
R7007:Ubap2 UTSW 4 41206221 missense probably damaging 0.97
R7048:Ubap2 UTSW 4 41196033 missense possibly damaging 0.49
R7121:Ubap2 UTSW 4 41205550 missense probably benign 0.00
R7371:Ubap2 UTSW 4 41195779 missense probably benign 0.16
R7378:Ubap2 UTSW 4 41235515 critical splice donor site probably null
X0061:Ubap2 UTSW 4 41196507 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGTCAGGGTGAACCTAAGTCAG -3'
(R):5'- ACCATGCTGTGCCCCTTAACTG -3'

Sequencing Primer
(F):5'- CCTAGTGAGTTTGGGATATCACAAG -3'
(R):5'- TTAACTGCATGGGACCAGATACTG -3'
Posted On2014-05-23