Incidental Mutation 'R1772:Ptpro'
ID196694
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Nameprotein tyrosine phosphatase, receptor type, O
SynonymsPtpn15, PTP-oc, GLEPP1, PTP-U2, PTP-BK, PTP-phi, D28, PTPROt
MMRRC Submission 039803-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1772 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location137252319-137463233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137430743 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 922 (L922P)
Ref Sequence ENSEMBL: ENSMUSP00000127112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167002] [ENSMUST00000167679] [ENSMUST00000203914]
Predicted Effect probably damaging
Transcript: ENSMUST00000077115
AA Change: L950P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: L950P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167002
AA Change: L129P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131764
Gene: ENSMUSG00000030223
AA Change: L129P

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
PTPc 126 386 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167679
AA Change: L922P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: L922P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000203914
AA Change: L101P

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144870
Gene: ENSMUSG00000030223
AA Change: L101P

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
PTPc 98 358 6.1e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204925
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.5%
Validation Efficiency 97% (107/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,432 S1937P probably damaging Het
Adgb G T 10: 10,382,721 probably benign Het
Aldh1a7 T C 19: 20,716,019 K179E probably damaging Het
Angptl7 G A 4: 148,497,426 R168C probably damaging Het
Atp8b1 T A 18: 64,573,492 I208F possibly damaging Het
Bco1 A G 8: 117,130,608 Y438C probably benign Het
Btrc A C 19: 45,512,661 K218Q probably damaging Het
Cct8l1 G A 5: 25,517,699 V471M probably damaging Het
Cd180 C T 13: 102,706,242 L599F probably benign Het
Cd300e T C 11: 115,054,518 N150S probably benign Het
Clcn1 C A 6: 42,294,145 T281K probably damaging Het
Cnnm3 T C 1: 36,518,957 S417P probably damaging Het
Cspg4 T A 9: 56,897,492 S1862R probably benign Het
Cspg5 A T 9: 110,262,138 N432Y probably damaging Het
Cyp2r1 T A 7: 114,553,216 I169F probably damaging Het
D130043K22Rik T A 13: 24,875,999 S618T probably damaging Het
Diaph3 G A 14: 86,965,549 P635L probably damaging Het
Dlg1 A G 16: 31,665,667 I38V possibly damaging Het
Dlk1 T G 12: 109,459,759 V186G probably damaging Het
Dmxl2 T C 9: 54,423,224 probably benign Het
Dnajc17 G A 2: 119,183,683 R132* probably null Het
Dock9 G T 14: 121,609,798 N1042K probably benign Het
Dok7 A T 5: 35,086,650 Q511L probably damaging Het
Espnl G A 1: 91,344,603 E562K possibly damaging Het
Evi5 G A 5: 107,795,841 T562I probably benign Het
Exd2 T A 12: 80,489,479 D294E probably benign Het
Fbn1 A T 2: 125,403,228 D246E possibly damaging Het
Fbxw16 A T 9: 109,439,582 W247R possibly damaging Het
Fcer1a A G 1: 173,225,437 I64T probably benign Het
Fcgbp C A 7: 28,105,175 Q1903K possibly damaging Het
Fmn1 A G 2: 113,365,355 S467G unknown Het
Fndc7 T A 3: 108,870,534 T369S probably damaging Het
Fnta T C 8: 26,000,966 probably benign Het
Gak A T 5: 108,606,892 H289Q probably damaging Het
Gas2l3 A G 10: 89,417,014 probably benign Het
Gbp8 T C 5: 105,016,121 N437S probably benign Het
Gk5 G A 9: 96,150,797 probably null Het
Gm21818 T A 13: 120,173,189 D2E probably benign Het
Hid1 A T 11: 115,348,473 V788E probably damaging Het
Hmcn1 T C 1: 150,563,568 T5505A probably damaging Het
Igf1r T A 7: 68,195,074 M865K probably benign Het
Katnal2 G A 18: 77,002,537 T258I probably damaging Het
Kdm3b A T 18: 34,803,504 I280L probably benign Het
Kif24 A G 4: 41,409,787 V382A probably damaging Het
Kif2a A T 13: 106,978,132 probably benign Het
Klhl10 A G 11: 100,442,196 I56V probably benign Het
Klk6 C T 7: 43,829,271 Q201* probably null Het
Klra3 A T 6: 130,323,708 S233T probably benign Het
Krt9 A T 11: 100,191,305 M223K probably damaging Het
Lama4 G A 10: 39,060,224 E632K probably benign Het
Lamb1 T C 12: 31,278,525 Y163H probably damaging Het
Lipo1 A G 19: 33,787,421 I11T probably benign Het
Lix1l T A 3: 96,623,891 H333Q possibly damaging Het
Mal2 T A 15: 54,588,387 M68K probably damaging Het
Map2k2 T C 10: 81,121,100 I104T probably damaging Het
Matn2 T C 15: 34,428,785 V765A probably damaging Het
Mptx2 T A 1: 173,274,473 K216N probably damaging Het
Mup5 C T 4: 61,832,341 probably null Het
Mycbp2 A G 14: 103,182,419 Y2494H probably damaging Het
Myh3 G A 11: 67,099,394 D1622N probably benign Het
Myo6 T C 9: 80,270,049 I609T possibly damaging Het
Ndst1 G A 18: 60,702,837 T458I probably damaging Het
Neb A T 2: 52,235,677 Y3622N probably damaging Het
Ntm A G 9: 29,179,100 Y108H probably benign Het
Olfr273 T G 4: 52,855,730 K261T probably benign Het
Olfr43 T C 11: 74,206,572 I215V probably benign Het
Olfr596 T C 7: 103,310,242 Y174H possibly damaging Het
Pappa2 T A 1: 158,814,368 I1373F possibly damaging Het
Pear1 A G 3: 87,754,492 probably benign Het
Phc3 C T 3: 30,961,820 A81T probably damaging Het
Pmepa1 A G 2: 173,234,360 S105P probably damaging Het
Ppp6r1 T C 7: 4,642,031 I248V probably benign Het
Prdm4 G A 10: 85,893,392 T717I probably damaging Het
Prom1 T C 5: 44,011,224 T669A probably benign Het
Ptpn5 T A 7: 47,090,768 I96F probably benign Het
Reck A T 4: 43,890,982 H40L probably benign Het
Rreb1 T A 13: 37,930,923 C753S probably benign Het
Sacs T C 14: 61,210,897 L3464P probably damaging Het
Samsn1 A T 16: 75,870,775 D304E probably benign Het
Scgb2b3 T C 7: 31,360,196 N51S possibly damaging Het
Shroom3 T C 5: 92,940,656 S341P probably damaging Het
Siglece T C 7: 43,659,293 D212G probably damaging Het
Sirpa A G 2: 129,616,456 T331A probably damaging Het
Spata21 T C 4: 141,111,296 S553P possibly damaging Het
Speer4b T A 5: 27,500,238 probably benign Het
Srgap2 T C 1: 131,319,638 D552G probably damaging Het
Stab2 A G 10: 86,954,234 I556T probably benign Het
Strip1 C T 3: 107,626,731 probably null Het
Stxbp6 T A 12: 44,902,870 D92V probably damaging Het
Styx A G 14: 45,356,758 K46E probably damaging Het
Supt20 T A 3: 54,710,420 V314E probably damaging Het
Syne2 T A 12: 75,938,729 D1650E probably benign Het
Szt2 T A 4: 118,405,517 K21M probably damaging Het
Tbx4 A T 11: 85,911,207 H222L probably damaging Het
Tmx3 A T 18: 90,532,997 I254L probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpv2 A T 11: 62,594,226 probably benign Het
Ubap2 A G 4: 41,202,380 S683P probably benign Het
Ube2d3 C T 3: 135,465,211 R139W probably benign Het
Ubox5 G T 2: 130,591,874 Q518K probably benign Het
Usp42 T C 5: 143,717,102 N588S probably damaging Het
Vars2 G A 17: 35,660,084 T618M probably damaging Het
Wfdc17 A T 11: 83,704,904 N65Y probably damaging Het
Zbtb38 G A 9: 96,688,041 P330L probably damaging Het
Zfp385a C T 15: 103,315,881 probably null Het
Zfp637 T A 6: 117,845,412 L167H probably damaging Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137394909 critical splice donor site probably null
IGL00844:Ptpro APN 6 137414239 missense probably damaging 1.00
IGL00983:Ptpro APN 6 137418248 missense probably benign 0.01
IGL01073:Ptpro APN 6 137377088 missense probably damaging 1.00
IGL01832:Ptpro APN 6 137393668 missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137454700 missense probably benign 0.37
IGL02387:Ptpro APN 6 137410980 missense probably damaging 0.96
IGL02605:Ptpro APN 6 137380318 missense probably benign 0.02
IGL02666:Ptpro APN 6 137378059 missense probably damaging 0.96
IGL03275:Ptpro APN 6 137450006 missense probably damaging 1.00
court UTSW 6 137393675 nonsense probably null
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0020:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0022:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0023:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0024:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0103:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0106:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0316:Ptpro UTSW 6 137376989 missense possibly damaging 0.81
R0427:Ptpro UTSW 6 137368296 missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137414230 missense probably benign 0.04
R0536:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0537:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0552:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0555:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0664:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0708:Ptpro UTSW 6 137386253 missense probably benign 0.26
R0730:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0735:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0738:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0786:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0811:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0812:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0881:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0973:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1259:Ptpro UTSW 6 137392741 missense probably damaging 0.98
R1340:Ptpro UTSW 6 137441081 missense possibly damaging 0.95
R1381:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1382:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1385:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1396:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1401:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1416:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1422:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1448:Ptpro UTSW 6 137441116 missense probably damaging 1.00
R1513:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1518:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1526:Ptpro UTSW 6 137461726 missense probably damaging 1.00
R1540:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1571:Ptpro UTSW 6 137378130 missense probably benign
R1573:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1587:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1588:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1649:Ptpro UTSW 6 137444017 nonsense probably null
R1700:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1701:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1745:Ptpro UTSW 6 137400645 missense probably benign 0.03
R1911:Ptpro UTSW 6 137400619 splice site probably benign
R1958:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1967:Ptpro UTSW 6 137416865 missense probably benign 0.38
R2025:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2026:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2040:Ptpro UTSW 6 137386164 splice site probably benign
R2115:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2117:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2130:Ptpro UTSW 6 137411116 splice site probably null
R2161:Ptpro UTSW 6 137449887 missense probably benign 0.01
R2431:Ptpro UTSW 6 137443585 nonsense probably null
R2915:Ptpro UTSW 6 137414241 start gained probably benign
R2988:Ptpro UTSW 6 137443599 nonsense probably null
R3772:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3773:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3795:Ptpro UTSW 6 137380309 missense probably benign
R3885:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3886:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3887:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3888:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3893:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4032:Ptpro UTSW 6 137461742 missense probably damaging 1.00
R4133:Ptpro UTSW 6 137420372 missense probably damaging 1.00
R4377:Ptpro UTSW 6 137380266 missense probably benign 0.26
R4455:Ptpro UTSW 6 137393659 missense probably damaging 1.00
R4613:Ptpro UTSW 6 137416836 nonsense probably null
R4827:Ptpro UTSW 6 137442710 missense probably damaging 1.00
R4863:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4870:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R4910:Ptpro UTSW 6 137368338 missense probably damaging 0.99
R4932:Ptpro UTSW 6 137411105 nonsense probably null
R4941:Ptpro UTSW 6 137392765 missense probably damaging 1.00
R4989:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5009:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R5032:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5033:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5162:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5393:Ptpro UTSW 6 137380224 missense probably benign 0.04
R5423:Ptpro UTSW 6 137442707 missense probably damaging 1.00
R5782:Ptpro UTSW 6 137399498 missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137400706 missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137380608 missense probably benign 0.28
R6488:Ptpro UTSW 6 137393675 nonsense probably null
R6494:Ptpro UTSW 6 137382642 missense probably benign 0.20
R6746:Ptpro UTSW 6 137394823 missense probably damaging 1.00
R6763:Ptpro UTSW 6 137418281 splice site probably null
R6888:Ptpro UTSW 6 137380200 missense probably benign 0.30
R6983:Ptpro UTSW 6 137449917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGCGGTGTCATCCAATTACACAG -3'
(R):5'- AACAGCAAAGTCCCTGGAAGGTAAC -3'

Sequencing Primer
(F):5'- TCCAATTACACAGGTGTGGGG -3'
(R):5'- ATGCCAGGCATCAGTTTGC -3'
Posted On2014-05-23