Incidental Mutation 'R0081:Hk2'
ID19671
Institutional Source Beutler Lab
Gene Symbol Hk2
Ensembl Gene ENSMUSG00000000628
Gene Namehexokinase 2
SynonymsHKII
MMRRC Submission 038368-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0081 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location82725025-82774454 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 82734976 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000642] [ENSMUST00000170833]
Predicted Effect probably benign
Transcript: ENSMUST00000000642
SMART Domains Protein: ENSMUSP00000000642
Gene: ENSMUSG00000000628

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 220 9.8e-78 PFAM
Pfam:Hexokinase_2 225 459 4.9e-85 PFAM
Pfam:Hexokinase_1 469 668 6.4e-80 PFAM
Pfam:Hexokinase_2 673 907 8.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170833
SMART Domains Protein: ENSMUSP00000125986
Gene: ENSMUSG00000000628

DomainStartEndE-ValueType
Pfam:Hexokinase_1 1 193 5.5e-89 PFAM
Pfam:Hexokinase_2 195 434 5.3e-107 PFAM
Pfam:Hexokinase_1 436 641 5.9e-91 PFAM
Pfam:Hexokinase_2 643 882 1.3e-109 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.2%
  • 10x: 88.5%
  • 20x: 63.6%
Validation Efficiency 94% (159/169)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes hexokinase 2, the predominant form found in skeletal muscle. It localizes to the outer membrane of mitochondria. Expression of this gene is insulin-responsive, and studies in rat suggest that it is involved in the increased rate of glycolysis seen in rapidly growing cancer cells. [provided by RefSeq, Apr 2009]
PHENOTYPE: Embryos homozygous for a knock-out mutation are severely growth retarded and die around E8.5. Interestingly, heterozygous mutant mice are viable and fertile, develop normally and do not exhibit impaired insulin action or glucose tolerance even when challenged with a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T C 8: 24,781,687 D485G probably damaging Het
Adamts19 T C 18: 58,903,065 probably null Het
Adgrd1 A T 5: 129,178,082 I598F probably damaging Het
Adh5 A G 3: 138,451,413 D245G probably benign Het
Adra2b T C 2: 127,364,292 V238A probably benign Het
Ank1 G A 8: 23,116,242 V1188I possibly damaging Het
Asap1 C T 15: 64,099,564 G905D probably damaging Het
AW554918 T C 18: 25,344,902 V428A probably benign Het
Birc6 T A 17: 74,643,441 S3226T probably benign Het
Cdh17 A T 4: 11,785,280 probably benign Het
Cyfip2 A T 11: 46,253,998 Y676* probably null Het
Dcaf17 T A 2: 71,078,468 probably benign Het
Dclre1a A G 19: 56,542,707 F736L probably damaging Het
Ddx41 A T 13: 55,535,380 H171Q possibly damaging Het
Dennd5b G T 6: 148,993,759 Q1258K probably benign Het
Dock10 T C 1: 80,606,578 D137G probably damaging Het
Dpyd G A 3: 118,944,255 V482I probably benign Het
Erich6 A T 3: 58,636,126 probably benign Het
Fam193b A G 13: 55,554,211 probably benign Het
Foxp2 T C 6: 15,405,644 probably benign Het
Frmd4a T C 2: 4,572,441 probably null Het
Gas2l2 A G 11: 83,422,867 S540P possibly damaging Het
Glis2 T C 16: 4,613,653 V348A probably benign Het
Gm14443 C A 2: 175,169,936 G239V probably damaging Het
Gpr158 T C 2: 21,826,717 V876A probably damaging Het
H1foo A G 6: 115,949,981 E273G probably benign Het
Hadh C T 3: 131,235,636 D245N probably damaging Het
Ice1 A T 13: 70,619,044 Y108* probably null Het
Il10ra T G 9: 45,255,949 M435L probably benign Het
Inpp5k GT G 11: 75,631,147 probably null Het
Kank4 G T 4: 98,778,330 P627T probably benign Het
Kif16b A G 2: 142,707,426 probably benign Het
Lipn A G 19: 34,076,976 I205V probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myh1 T C 11: 67,215,857 M1255T probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo1d T G 11: 80,557,523 K925N probably benign Het
Myoz1 T A 14: 20,649,554 M239L probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nf1 C A 11: 79,453,979 probably benign Het
Npepl1 C T 2: 174,116,086 P239S probably damaging Het
Olfml1 A G 7: 107,571,299 K131R probably benign Het
Olfr1258 T A 2: 89,930,079 I90K possibly damaging Het
Olfr1303 A C 2: 111,813,868 I286S probably damaging Het
Olfr344 T A 2: 36,568,881 Y94* probably null Het
Olfr352 T C 2: 36,870,010 L148S possibly damaging Het
Olfr358 G A 2: 37,005,450 L55F probably damaging Het
Olfr389 A G 11: 73,777,109 F73L possibly damaging Het
Olfr472 C T 7: 107,903,005 T96I probably benign Het
Olfr771 C T 10: 129,160,838 D49N possibly damaging Het
Pde7a T C 3: 19,241,533 probably benign Het
Pik3c2g T C 6: 139,957,793 C591R probably benign Het
Pkn2 T G 3: 142,853,582 K61Q probably damaging Het
Ppfia1 C A 7: 144,504,974 G722C probably damaging Het
Ppp1cb T C 5: 32,487,614 V263A probably damaging Het
Rab11fip2 A T 19: 59,907,135 N440K possibly damaging Het
Rbm34 T A 8: 126,949,484 K340N probably damaging Het
Samd3 T C 10: 26,271,501 probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sigirr T C 7: 141,091,372 D399G probably damaging Het
Slc17a7 A G 7: 45,174,947 E554G probably benign Het
Smc3 A G 19: 53,601,562 probably benign Het
Tdrd1 T C 19: 56,831,271 Y68H probably benign Het
Tespa1 T A 10: 130,360,850 L219Q probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Ttc38 A G 15: 85,856,472 S436G probably benign Het
Ttn T A 2: 76,751,079 I23157F probably damaging Het
Ubxn2b T A 4: 6,203,875 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r72 T C 7: 85,751,836 E125G probably benign Het
Vmn2r78 A T 7: 86,923,027 D532V probably benign Het
Vwa8 C A 14: 79,082,782 L1078I probably benign Het
Vwce A T 19: 10,664,089 probably null Het
Zpr1 A G 9: 46,279,697 D300G probably damaging Het
Other mutations in Hk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Hk2 APN 6 82729552 missense possibly damaging 0.93
IGL01484:Hk2 APN 6 82736730 missense probably damaging 1.00
IGL01786:Hk2 APN 6 82739553 missense probably benign 0.13
IGL02164:Hk2 APN 6 82743939 splice site probably null
IGL02293:Hk2 APN 6 82743975 missense probably benign 0.00
IGL02861:Hk2 APN 6 82760158 missense possibly damaging 0.73
IGL03029:Hk2 APN 6 82738333 missense probably damaging 1.00
IGL03063:Hk2 APN 6 82739649 missense probably damaging 1.00
IGL03063:Hk2 APN 6 82749232 missense probably benign 0.23
IGL02799:Hk2 UTSW 6 82760238 missense probably damaging 1.00
PIT4243001:Hk2 UTSW 6 82730877 missense probably damaging 1.00
R0069:Hk2 UTSW 6 82736528 critical splice donor site probably null
R0981:Hk2 UTSW 6 82743968 missense probably damaging 1.00
R1234:Hk2 UTSW 6 82760248 missense possibly damaging 0.95
R1239:Hk2 UTSW 6 82749308 missense probably damaging 1.00
R1695:Hk2 UTSW 6 82744951 missense probably damaging 0.99
R1891:Hk2 UTSW 6 82749283 missense probably benign 0.01
R2338:Hk2 UTSW 6 82731115 missense probably damaging 1.00
R3854:Hk2 UTSW 6 82736676 missense possibly damaging 0.87
R3855:Hk2 UTSW 6 82736676 missense possibly damaging 0.87
R3856:Hk2 UTSW 6 82736676 missense possibly damaging 0.87
R3887:Hk2 UTSW 6 82734961 missense possibly damaging 0.72
R4382:Hk2 UTSW 6 82735341 missense probably null 1.00
R4684:Hk2 UTSW 6 82739648 missense probably damaging 1.00
R4705:Hk2 UTSW 6 82739650 missense possibly damaging 0.95
R4735:Hk2 UTSW 6 82744974 missense probably benign 0.40
R5014:Hk2 UTSW 6 82743955 missense possibly damaging 0.73
R5552:Hk2 UTSW 6 82730823 missense possibly damaging 0.87
R5914:Hk2 UTSW 6 82736634 missense probably benign
R6212:Hk2 UTSW 6 82728842 missense probably benign 0.02
R6276:Hk2 UTSW 6 82743366 missense probably benign 0.05
R6369:Hk2 UTSW 6 82736753 missense probably damaging 1.00
R7175:Hk2 UTSW 6 82734849 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTTAGGGTTGAGGAAGCCCATAG -3'
(R):5'- AACAAACTTCCGGGTCCTGCTG -3'

Sequencing Primer
(F):5'- TAGGAGAGCCCTCCCAGAAG -3'
(R):5'- TCTGGGATGATTCAGCGACC -3'
Posted On2013-04-11