Incidental Mutation 'R1772:Stab2'
ID196719
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Namestabilin 2
SynonymsSTAB-2, FEEL-2
MMRRC Submission 039803-MU
Accession Numbers

Genbank: NM_138673; MGI: 2178743

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1772 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location86841198-87008025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86954234 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 556 (I556T)
Ref Sequence ENSEMBL: ENSMUSP00000048309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
Predicted Effect probably benign
Transcript: ENSMUST00000035288
AA Change: I556T

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: I556T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Meta Mutation Damage Score 0.1232 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.5%
Validation Efficiency 97% (107/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,432 S1937P probably damaging Het
Adgb G T 10: 10,382,721 probably benign Het
Aldh1a7 T C 19: 20,716,019 K179E probably damaging Het
Angptl7 G A 4: 148,497,426 R168C probably damaging Het
Atp8b1 T A 18: 64,573,492 I208F possibly damaging Het
Bco1 A G 8: 117,130,608 Y438C probably benign Het
Btrc A C 19: 45,512,661 K218Q probably damaging Het
Cct8l1 G A 5: 25,517,699 V471M probably damaging Het
Cd180 C T 13: 102,706,242 L599F probably benign Het
Cd300e T C 11: 115,054,518 N150S probably benign Het
Clcn1 C A 6: 42,294,145 T281K probably damaging Het
Cnnm3 T C 1: 36,518,957 S417P probably damaging Het
Cspg4 T A 9: 56,897,492 S1862R probably benign Het
Cspg5 A T 9: 110,262,138 N432Y probably damaging Het
Cyp2r1 T A 7: 114,553,216 I169F probably damaging Het
D130043K22Rik T A 13: 24,875,999 S618T probably damaging Het
Diaph3 G A 14: 86,965,549 P635L probably damaging Het
Dlg1 A G 16: 31,665,667 I38V possibly damaging Het
Dlk1 T G 12: 109,459,759 V186G probably damaging Het
Dmxl2 T C 9: 54,423,224 probably benign Het
Dnajc17 G A 2: 119,183,683 R132* probably null Het
Dock9 G T 14: 121,609,798 N1042K probably benign Het
Dok7 A T 5: 35,086,650 Q511L probably damaging Het
Espnl G A 1: 91,344,603 E562K possibly damaging Het
Evi5 G A 5: 107,795,841 T562I probably benign Het
Exd2 T A 12: 80,489,479 D294E probably benign Het
Fbn1 A T 2: 125,403,228 D246E possibly damaging Het
Fbxw16 A T 9: 109,439,582 W247R possibly damaging Het
Fcer1a A G 1: 173,225,437 I64T probably benign Het
Fcgbp C A 7: 28,105,175 Q1903K possibly damaging Het
Fmn1 A G 2: 113,365,355 S467G unknown Het
Fndc7 T A 3: 108,870,534 T369S probably damaging Het
Fnta T C 8: 26,000,966 probably benign Het
Gak A T 5: 108,606,892 H289Q probably damaging Het
Gas2l3 A G 10: 89,417,014 probably benign Het
Gbp8 T C 5: 105,016,121 N437S probably benign Het
Gk5 G A 9: 96,150,797 probably null Het
Gm21818 T A 13: 120,173,189 D2E probably benign Het
Hid1 A T 11: 115,348,473 V788E probably damaging Het
Hmcn1 T C 1: 150,563,568 T5505A probably damaging Het
Igf1r T A 7: 68,195,074 M865K probably benign Het
Katnal2 G A 18: 77,002,537 T258I probably damaging Het
Kdm3b A T 18: 34,803,504 I280L probably benign Het
Kif24 A G 4: 41,409,787 V382A probably damaging Het
Kif2a A T 13: 106,978,132 probably benign Het
Klhl10 A G 11: 100,442,196 I56V probably benign Het
Klk6 C T 7: 43,829,271 Q201* probably null Het
Klra3 A T 6: 130,323,708 S233T probably benign Het
Krt9 A T 11: 100,191,305 M223K probably damaging Het
Lama4 G A 10: 39,060,224 E632K probably benign Het
Lamb1 T C 12: 31,278,525 Y163H probably damaging Het
Lipo1 A G 19: 33,787,421 I11T probably benign Het
Lix1l T A 3: 96,623,891 H333Q possibly damaging Het
Mal2 T A 15: 54,588,387 M68K probably damaging Het
Map2k2 T C 10: 81,121,100 I104T probably damaging Het
Matn2 T C 15: 34,428,785 V765A probably damaging Het
Mptx2 T A 1: 173,274,473 K216N probably damaging Het
Mup5 C T 4: 61,832,341 probably null Het
Mycbp2 A G 14: 103,182,419 Y2494H probably damaging Het
Myh3 G A 11: 67,099,394 D1622N probably benign Het
Myo6 T C 9: 80,270,049 I609T possibly damaging Het
Ndst1 G A 18: 60,702,837 T458I probably damaging Het
Neb A T 2: 52,235,677 Y3622N probably damaging Het
Ntm A G 9: 29,179,100 Y108H probably benign Het
Olfr273 T G 4: 52,855,730 K261T probably benign Het
Olfr43 T C 11: 74,206,572 I215V probably benign Het
Olfr596 T C 7: 103,310,242 Y174H possibly damaging Het
Pappa2 T A 1: 158,814,368 I1373F possibly damaging Het
Pear1 A G 3: 87,754,492 probably benign Het
Phc3 C T 3: 30,961,820 A81T probably damaging Het
Pmepa1 A G 2: 173,234,360 S105P probably damaging Het
Ppp6r1 T C 7: 4,642,031 I248V probably benign Het
Prdm4 G A 10: 85,893,392 T717I probably damaging Het
Prom1 T C 5: 44,011,224 T669A probably benign Het
Ptpn5 T A 7: 47,090,768 I96F probably benign Het
Ptpro T C 6: 137,430,743 L922P probably damaging Het
Reck A T 4: 43,890,982 H40L probably benign Het
Rreb1 T A 13: 37,930,923 C753S probably benign Het
Sacs T C 14: 61,210,897 L3464P probably damaging Het
Samsn1 A T 16: 75,870,775 D304E probably benign Het
Scgb2b3 T C 7: 31,360,196 N51S possibly damaging Het
Shroom3 T C 5: 92,940,656 S341P probably damaging Het
Siglece T C 7: 43,659,293 D212G probably damaging Het
Sirpa A G 2: 129,616,456 T331A probably damaging Het
Spata21 T C 4: 141,111,296 S553P possibly damaging Het
Speer4b T A 5: 27,500,238 probably benign Het
Srgap2 T C 1: 131,319,638 D552G probably damaging Het
Strip1 C T 3: 107,626,731 probably null Het
Stxbp6 T A 12: 44,902,870 D92V probably damaging Het
Styx A G 14: 45,356,758 K46E probably damaging Het
Supt20 T A 3: 54,710,420 V314E probably damaging Het
Syne2 T A 12: 75,938,729 D1650E probably benign Het
Szt2 T A 4: 118,405,517 K21M probably damaging Het
Tbx4 A T 11: 85,911,207 H222L probably damaging Het
Tmx3 A T 18: 90,532,997 I254L probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpv2 A T 11: 62,594,226 probably benign Het
Ubap2 A G 4: 41,202,380 S683P probably benign Het
Ube2d3 C T 3: 135,465,211 R139W probably benign Het
Ubox5 G T 2: 130,591,874 Q518K probably benign Het
Usp42 T C 5: 143,717,102 N588S probably damaging Het
Vars2 G A 17: 35,660,084 T618M probably damaging Het
Wfdc17 A T 11: 83,704,904 N65Y probably damaging Het
Zbtb38 G A 9: 96,688,041 P330L probably damaging Het
Zfp385a C T 15: 103,315,881 probably null Het
Zfp637 T A 6: 117,845,412 L167H probably damaging Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86869206 unclassified probably null
IGL00809:Stab2 APN 10 86848174 splice site probably benign
IGL00911:Stab2 APN 10 86969753 missense probably damaging 1.00
IGL01347:Stab2 APN 10 86901703 splice site probably null
IGL01411:Stab2 APN 10 86980008 splice site probably benign
IGL01503:Stab2 APN 10 86940613 splice site probably benign
IGL01599:Stab2 APN 10 86922895 missense probably damaging 1.00
IGL01635:Stab2 APN 10 86981128 missense probably benign 0.04
IGL01640:Stab2 APN 10 86954171 missense probably benign 0.09
IGL01671:Stab2 APN 10 86969277 missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86871831 missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86967650 missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86859742 unclassified probably null
IGL02600:Stab2 APN 10 86954259 missense probably damaging 1.00
IGL02666:Stab2 APN 10 86850902 missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86846163 splice site probably benign
IGL02709:Stab2 APN 10 86846165 splice site probably benign
IGL02728:Stab2 APN 10 86856556 missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86950269 splice site probably benign
IGL02938:Stab2 APN 10 86871921 missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86996803 critical splice donor site probably null
IGL03238:Stab2 APN 10 86855121 missense probably damaging 1.00
IGL03402:Stab2 APN 10 86969301 missense probably benign 0.03
3-1:Stab2 UTSW 10 86869177 missense probably damaging 0.96
F6893:Stab2 UTSW 10 86855171 missense probably damaging 1.00
K7371:Stab2 UTSW 10 86943289 critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86867175 missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86861435 nonsense probably null
R0015:Stab2 UTSW 10 86843617 missense probably benign
R0254:Stab2 UTSW 10 86897960 missense probably benign
R0310:Stab2 UTSW 10 86967613 splice site probably benign
R0333:Stab2 UTSW 10 86841627 missense probably benign
R0391:Stab2 UTSW 10 86947144 missense probably benign 0.27
R0400:Stab2 UTSW 10 86872610 missense probably damaging 1.00
R0433:Stab2 UTSW 10 86843491 splice site probably benign
R0440:Stab2 UTSW 10 86949928 missense probably benign 0.23
R0743:Stab2 UTSW 10 86887895 missense probably damaging 1.00
R0847:Stab2 UTSW 10 86969871 missense probably benign 0.00
R0883:Stab2 UTSW 10 86924450 splice site probably benign
R1078:Stab2 UTSW 10 86907133 splice site probably null
R1118:Stab2 UTSW 10 86885718 unclassified probably null
R1119:Stab2 UTSW 10 86859755 missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86950301 missense probably damaging 0.98
R1440:Stab2 UTSW 10 86861367 unclassified probably null
R1550:Stab2 UTSW 10 86878926 missense probably benign 0.01
R1616:Stab2 UTSW 10 86885718 unclassified probably null
R1728:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1768:Stab2 UTSW 10 87003008 missense probably damaging 1.00
R1776:Stab2 UTSW 10 86957816 missense possibly damaging 0.92
R1784:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1892:Stab2 UTSW 10 86938049 missense probably damaging 0.99
R1957:Stab2 UTSW 10 86861470 missense probably benign 0.13
R1972:Stab2 UTSW 10 86960316 missense probably damaging 0.99
R1975:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1976:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1996:Stab2 UTSW 10 87003031 missense probably damaging 1.00
R2085:Stab2 UTSW 10 86954159 missense probably damaging 1.00
R2149:Stab2 UTSW 10 86865040 nonsense probably null
R2169:Stab2 UTSW 10 86887862 missense probably damaging 1.00
R2201:Stab2 UTSW 10 86940639 missense probably benign 0.22
R2296:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86969319 missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86934840 splice site probably benign
R2696:Stab2 UTSW 10 86861499 missense probably benign 0.45
R2883:Stab2 UTSW 10 86967686 missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86861461 missense probably damaging 1.00
R3711:Stab2 UTSW 10 86866708 missense probably damaging 1.00
R3787:Stab2 UTSW 10 86969277 missense possibly damaging 0.50
R3834:Stab2 UTSW 10 86949912 missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86878886 missense probably damaging 0.97
R3979:Stab2 UTSW 10 86863456 missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86858124 missense probably damaging 1.00
R4088:Stab2 UTSW 10 86922185 missense probably damaging 1.00
R4151:Stab2 UTSW 10 87002983 missense probably benign 0.12
R4190:Stab2 UTSW 10 86878944 missense probably damaging 0.98
R4556:Stab2 UTSW 10 86967679 missense possibly damaging 0.95
R4773:Stab2 UTSW 10 86907371 nonsense probably null
R4825:Stab2 UTSW 10 86947147 missense probably benign 0.08
R4865:Stab2 UTSW 10 86843500 unclassified probably null
R4871:Stab2 UTSW 10 86942235 missense probably damaging 0.99
R4943:Stab2 UTSW 10 86954162 missense probably damaging 0.99
R4981:Stab2 UTSW 10 86960223 missense probably benign
R4994:Stab2 UTSW 10 86949907 missense probably benign
R4999:Stab2 UTSW 10 86937909 missense probably damaging 0.97
R5061:Stab2 UTSW 10 86907385 missense probably damaging 1.00
R5072:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5073:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5074:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5134:Stab2 UTSW 10 86871810 unclassified probably null
R5213:Stab2 UTSW 10 86907197 missense probably damaging 0.99
R5508:Stab2 UTSW 10 86960279 missense probably benign 0.01
R5530:Stab2 UTSW 10 86947162 missense probably benign 0.04
R5540:Stab2 UTSW 10 86848125 missense probably benign 0.30
R5839:Stab2 UTSW 10 86872691 missense probably damaging 0.97
R5949:Stab2 UTSW 10 86969849 missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86938042 missense probably damaging 0.99
R6019:Stab2 UTSW 10 87003022 missense probably benign 0.00
R6116:Stab2 UTSW 10 86907190 missense probably damaging 1.00
R6131:Stab2 UTSW 10 86883778 unclassified probably null
R6209:Stab2 UTSW 10 86923003 missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86907161 missense probably damaging 1.00
R6433:Stab2 UTSW 10 86901567 splice site probably null
R6787:Stab2 UTSW 10 86919084 missense probably benign 0.07
R6841:Stab2 UTSW 10 86942190 missense probably damaging 1.00
R6873:Stab2 UTSW 10 86861366 critical splice donor site probably null
R7025:Stab2 UTSW 10 86850837 missense probably damaging 1.00
R7043:Stab2 UTSW 10 86870246 missense probably damaging 0.99
R7047:Stab2 UTSW 10 86858152 missense probably damaging 1.00
R7107:Stab2 UTSW 10 86905592 missense possibly damaging 0.96
R7214:Stab2 UTSW 10 86899841 missense probably damaging 0.99
R7271:Stab2 UTSW 10 87003108 splice site probably null
R7291:Stab2 UTSW 10 86946220 missense probably damaging 0.96
R7336:Stab2 UTSW 10 86969185 nonsense probably null
R7432:Stab2 UTSW 10 86885683 missense probably damaging 0.99
X0023:Stab2 UTSW 10 86922198 critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86887816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCCTAAGTGACCTAATGACGG -3'
(R):5'- TCGATCATGCAGACTCACACTTTCATC -3'

Sequencing Primer
(F):5'- atctatctgtctgtctgtctgtc -3'
(R):5'- GAGGTAAGAACTCTCAAACTTTCCAG -3'
Posted On2014-05-23