Incidental Mutation 'R1772:Kif2a'
ID196739
Institutional Source Beutler Lab
Gene Symbol Kif2a
Ensembl Gene ENSMUSG00000021693
Gene Namekinesin family member 2A
SynonymsKns2, Kif2, M-kinesin
MMRRC Submission 039803-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1772 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location106958996-107022126 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 106978132 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022204] [ENSMUST00000117423] [ENSMUST00000117539] [ENSMUST00000122233] [ENSMUST00000159772]
Predicted Effect probably benign
Transcript: ENSMUST00000022204
SMART Domains Protein: ENSMUSP00000022204
Gene: ENSMUSG00000021693

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
low complexity region 159 183 N/A INTRINSIC
KISc 220 560 6.56e-147 SMART
low complexity region 613 625 N/A INTRINSIC
coiled coil region 660 698 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117423
SMART Domains Protein: ENSMUSP00000113921
Gene: ENSMUSG00000021693

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 113 137 N/A INTRINSIC
KISc 174 514 6.56e-147 SMART
low complexity region 567 579 N/A INTRINSIC
coiled coil region 614 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117539
SMART Domains Protein: ENSMUSP00000113361
Gene: ENSMUSG00000021693

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
low complexity region 143 167 N/A INTRINSIC
KISc 204 544 6.56e-147 SMART
low complexity region 597 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122233
SMART Domains Protein: ENSMUSP00000112715
Gene: ENSMUSG00000021693

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 132 156 N/A INTRINSIC
KISc 193 533 4.33e-147 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
coiled coil region 671 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159772
SMART Domains Protein: ENSMUSP00000125644
Gene: ENSMUSG00000021693

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
low complexity region 159 183 N/A INTRINSIC
KISc 220 560 4.33e-147 SMART
low complexity region 569 583 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
coiled coil region 698 736 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162845
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.5%
Validation Efficiency 97% (107/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plus end-directed motor required for normal mitotic progression. The encoded protein is required for normal spindle activity during mitosis and is necessary for normal brain development. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality, abnormal lamination of the cerebral cortex, hippocampus and cerebellum, impaired neuronal migration, and abnormal axon outgrowth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,432 S1937P probably damaging Het
Adgb G T 10: 10,382,721 probably benign Het
Aldh1a7 T C 19: 20,716,019 K179E probably damaging Het
Angptl7 G A 4: 148,497,426 R168C probably damaging Het
Atp8b1 T A 18: 64,573,492 I208F possibly damaging Het
Bco1 A G 8: 117,130,608 Y438C probably benign Het
Btrc A C 19: 45,512,661 K218Q probably damaging Het
Cct8l1 G A 5: 25,517,699 V471M probably damaging Het
Cd180 C T 13: 102,706,242 L599F probably benign Het
Cd300e T C 11: 115,054,518 N150S probably benign Het
Clcn1 C A 6: 42,294,145 T281K probably damaging Het
Cnnm3 T C 1: 36,518,957 S417P probably damaging Het
Cspg4 T A 9: 56,897,492 S1862R probably benign Het
Cspg5 A T 9: 110,262,138 N432Y probably damaging Het
Cyp2r1 T A 7: 114,553,216 I169F probably damaging Het
D130043K22Rik T A 13: 24,875,999 S618T probably damaging Het
Diaph3 G A 14: 86,965,549 P635L probably damaging Het
Dlg1 A G 16: 31,665,667 I38V possibly damaging Het
Dlk1 T G 12: 109,459,759 V186G probably damaging Het
Dmxl2 T C 9: 54,423,224 probably benign Het
Dnajc17 G A 2: 119,183,683 R132* probably null Het
Dock9 G T 14: 121,609,798 N1042K probably benign Het
Dok7 A T 5: 35,086,650 Q511L probably damaging Het
Espnl G A 1: 91,344,603 E562K possibly damaging Het
Evi5 G A 5: 107,795,841 T562I probably benign Het
Exd2 T A 12: 80,489,479 D294E probably benign Het
Fbn1 A T 2: 125,403,228 D246E possibly damaging Het
Fbxw16 A T 9: 109,439,582 W247R possibly damaging Het
Fcer1a A G 1: 173,225,437 I64T probably benign Het
Fcgbp C A 7: 28,105,175 Q1903K possibly damaging Het
Fmn1 A G 2: 113,365,355 S467G unknown Het
Fndc7 T A 3: 108,870,534 T369S probably damaging Het
Fnta T C 8: 26,000,966 probably benign Het
Gak A T 5: 108,606,892 H289Q probably damaging Het
Gas2l3 A G 10: 89,417,014 probably benign Het
Gbp8 T C 5: 105,016,121 N437S probably benign Het
Gk5 G A 9: 96,150,797 probably null Het
Gm21818 T A 13: 120,173,189 D2E probably benign Het
Hid1 A T 11: 115,348,473 V788E probably damaging Het
Hmcn1 T C 1: 150,563,568 T5505A probably damaging Het
Igf1r T A 7: 68,195,074 M865K probably benign Het
Katnal2 G A 18: 77,002,537 T258I probably damaging Het
Kdm3b A T 18: 34,803,504 I280L probably benign Het
Kif24 A G 4: 41,409,787 V382A probably damaging Het
Klhl10 A G 11: 100,442,196 I56V probably benign Het
Klk6 C T 7: 43,829,271 Q201* probably null Het
Klra3 A T 6: 130,323,708 S233T probably benign Het
Krt9 A T 11: 100,191,305 M223K probably damaging Het
Lama4 G A 10: 39,060,224 E632K probably benign Het
Lamb1 T C 12: 31,278,525 Y163H probably damaging Het
Lipo1 A G 19: 33,787,421 I11T probably benign Het
Lix1l T A 3: 96,623,891 H333Q possibly damaging Het
Mal2 T A 15: 54,588,387 M68K probably damaging Het
Map2k2 T C 10: 81,121,100 I104T probably damaging Het
Matn2 T C 15: 34,428,785 V765A probably damaging Het
Mptx2 T A 1: 173,274,473 K216N probably damaging Het
Mup5 C T 4: 61,832,341 probably null Het
Mycbp2 A G 14: 103,182,419 Y2494H probably damaging Het
Myh3 G A 11: 67,099,394 D1622N probably benign Het
Myo6 T C 9: 80,270,049 I609T possibly damaging Het
Ndst1 G A 18: 60,702,837 T458I probably damaging Het
Neb A T 2: 52,235,677 Y3622N probably damaging Het
Ntm A G 9: 29,179,100 Y108H probably benign Het
Olfr273 T G 4: 52,855,730 K261T probably benign Het
Olfr43 T C 11: 74,206,572 I215V probably benign Het
Olfr596 T C 7: 103,310,242 Y174H possibly damaging Het
Pappa2 T A 1: 158,814,368 I1373F possibly damaging Het
Pear1 A G 3: 87,754,492 probably benign Het
Phc3 C T 3: 30,961,820 A81T probably damaging Het
Pmepa1 A G 2: 173,234,360 S105P probably damaging Het
Ppp6r1 T C 7: 4,642,031 I248V probably benign Het
Prdm4 G A 10: 85,893,392 T717I probably damaging Het
Prom1 T C 5: 44,011,224 T669A probably benign Het
Ptpn5 T A 7: 47,090,768 I96F probably benign Het
Ptpro T C 6: 137,430,743 L922P probably damaging Het
Reck A T 4: 43,890,982 H40L probably benign Het
Rreb1 T A 13: 37,930,923 C753S probably benign Het
Sacs T C 14: 61,210,897 L3464P probably damaging Het
Samsn1 A T 16: 75,870,775 D304E probably benign Het
Scgb2b3 T C 7: 31,360,196 N51S possibly damaging Het
Shroom3 T C 5: 92,940,656 S341P probably damaging Het
Siglece T C 7: 43,659,293 D212G probably damaging Het
Sirpa A G 2: 129,616,456 T331A probably damaging Het
Spata21 T C 4: 141,111,296 S553P possibly damaging Het
Speer4b T A 5: 27,500,238 probably benign Het
Srgap2 T C 1: 131,319,638 D552G probably damaging Het
Stab2 A G 10: 86,954,234 I556T probably benign Het
Strip1 C T 3: 107,626,731 probably null Het
Stxbp6 T A 12: 44,902,870 D92V probably damaging Het
Styx A G 14: 45,356,758 K46E probably damaging Het
Supt20 T A 3: 54,710,420 V314E probably damaging Het
Syne2 T A 12: 75,938,729 D1650E probably benign Het
Szt2 T A 4: 118,405,517 K21M probably damaging Het
Tbx4 A T 11: 85,911,207 H222L probably damaging Het
Tmx3 A T 18: 90,532,997 I254L probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpv2 A T 11: 62,594,226 probably benign Het
Ubap2 A G 4: 41,202,380 S683P probably benign Het
Ube2d3 C T 3: 135,465,211 R139W probably benign Het
Ubox5 G T 2: 130,591,874 Q518K probably benign Het
Usp42 T C 5: 143,717,102 N588S probably damaging Het
Vars2 G A 17: 35,660,084 T618M probably damaging Het
Wfdc17 A T 11: 83,704,904 N65Y probably damaging Het
Zbtb38 G A 9: 96,688,041 P330L probably damaging Het
Zfp385a C T 15: 103,315,881 probably null Het
Zfp637 T A 6: 117,845,412 L167H probably damaging Het
Other mutations in Kif2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Kif2a APN 13 106968793 splice site probably benign
IGL01640:Kif2a APN 13 106974552 missense probably damaging 1.00
IGL02524:Kif2a APN 13 106964355 missense possibly damaging 0.82
R0088:Kif2a UTSW 13 106975432 missense probably damaging 1.00
R0276:Kif2a UTSW 13 106976650 splice site probably benign
R1233:Kif2a UTSW 13 106987332 missense probably damaging 1.00
R1345:Kif2a UTSW 13 106993915 missense probably damaging 0.99
R1900:Kif2a UTSW 13 106976995 missense possibly damaging 0.46
R1932:Kif2a UTSW 13 106978091 missense probably benign 0.00
R2364:Kif2a UTSW 13 106976836 missense probably damaging 1.00
R3177:Kif2a UTSW 13 106976756 missense probably damaging 1.00
R3277:Kif2a UTSW 13 106976756 missense probably damaging 1.00
R4646:Kif2a UTSW 13 106962185 missense probably damaging 1.00
R5566:Kif2a UTSW 13 106993924 unclassified probably null 1.00
R5761:Kif2a UTSW 13 106962164 missense probably benign 0.05
R5797:Kif2a UTSW 13 106975376 missense probably damaging 1.00
R6812:Kif2a UTSW 13 106969751 missense probably benign 0.00
R7025:Kif2a UTSW 13 106982594 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTacacacatgcatacccacata -3'
(R):5'- CATGGTcaggcatggtagcacaa -3'

Sequencing Primer
(F):5'- gcatacccacatacacgcac -3'
(R):5'- aatttctctttctctcccttaacatc -3'
Posted On2014-05-23