Incidental Mutation 'R1773:Cryzl2'
ID196775
Institutional Source Beutler Lab
Gene Symbol Cryzl2
Ensembl Gene ENSMUSG00000033488
Gene Namecrystallin zeta like 2
SynonymsBC026585, quinone reductase-like 2
MMRRC Submission 039804-MU
Accession Numbers

Genbank: NM_001033284

Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R1773 (G1)
Quality Score196
Status Not validated
Chromosome1
Chromosomal Location157458577-157492638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 157470722 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 227 (K227R)
Ref Sequence ENSEMBL: ENSMUSP00000044945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046743] [ENSMUST00000119891] [ENSMUST00000193791]
Predicted Effect probably benign
Transcript: ENSMUST00000046743
AA Change: K227R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000044945
Gene: ENSMUSG00000033488
AA Change: K227R

DomainStartEndE-ValueType
Pfam:ADH_N 51 174 4.1e-14 PFAM
Pfam:ADH_zinc_N 175 309 2.5e-23 PFAM
Pfam:ADH_zinc_N_2 208 347 2.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119891
SMART Domains Protein: ENSMUSP00000113664
Gene: ENSMUSG00000033488

DomainStartEndE-ValueType
Pfam:ADH_N 51 159 1.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193791
SMART Domains Protein: ENSMUSP00000141717
Gene: ENSMUSG00000033488

DomainStartEndE-ValueType
Pfam:ADH_N 51 159 1.9e-15 PFAM
low complexity region 166 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194220
Predicted Effect probably benign
Transcript: ENSMUST00000195702
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,580,595 K334E probably damaging Het
Abca12 A G 1: 71,288,596 Y1442H probably damaging Het
Acot12 A G 13: 91,757,557 T79A probably benign Het
Adipoq A C 16: 23,155,238 Q26P unknown Het
Akap13 T A 7: 75,683,451 N1582K possibly damaging Het
Alg9 A G 9: 50,779,096 T133A probably benign Het
Anks3 T C 16: 4,947,294 T418A probably benign Het
Ano3 A C 2: 110,761,455 L37R probably damaging Het
Ano9 A G 7: 141,108,378 F178L possibly damaging Het
Arhgef12 A G 9: 43,005,542 probably null Het
Arl16 T A 11: 120,465,763 I137F possibly damaging Het
Brpf1 T A 6: 113,319,931 S959T possibly damaging Het
C530008M17Rik G T 5: 76,867,205 A42S possibly damaging Het
Ccdc27 C T 4: 154,041,765 R89Q unknown Het
Cd109 A C 9: 78,703,724 Q1207H probably benign Het
Cd14 A T 18: 36,725,304 V366D possibly damaging Het
Cep290 G A 10: 100,510,573 V538I probably benign Het
Cep57 G A 9: 13,816,068 A202V probably damaging Het
Chl1 T C 6: 103,647,331 probably null Het
Cmah T G 13: 24,417,299 F29L probably benign Het
Crybg1 A G 10: 43,992,548 V1378A possibly damaging Het
D130043K22Rik T G 13: 24,882,602 V794G possibly damaging Het
Ddx4 T A 13: 112,599,902 T645S probably benign Het
Dhcr7 C T 7: 143,847,458 R453C possibly damaging Het
Dhx8 T C 11: 101,752,363 Y754H possibly damaging Het
Dip2b T A 15: 100,193,961 D860E probably benign Het
Dnah7a T C 1: 53,432,887 probably null Het
Dst A G 1: 34,291,899 D6937G probably damaging Het
Dusp1 A G 17: 26,507,107 I204T probably damaging Het
Dync2h1 T A 9: 7,128,256 Q1859L probably damaging Het
E4f1 C A 17: 24,446,584 G328V probably damaging Het
Eml5 T C 12: 98,798,839 Y1617C probably damaging Het
Espn G T 4: 152,128,229 P622Q probably damaging Het
Fam184b G A 5: 45,584,334 P185L possibly damaging Het
Fam71f1 T C 6: 29,334,153 S335P possibly damaging Het
Fn1 T A 1: 71,637,383 D563V probably damaging Het
Gad2 A G 2: 22,690,207 Y540C probably benign Het
Gdf11 T C 10: 128,891,294 D131G probably damaging Het
Gm19965 T A 1: 116,821,259 Y223* probably null Het
H2-M10.6 A G 17: 36,812,184 K3R probably benign Het
Hid1 A G 11: 115,348,510 Y776H probably damaging Het
Hivep3 A T 4: 120,098,837 K1450I probably damaging Het
Icam5 T C 9: 21,033,525 L128P possibly damaging Het
Idnk T C 13: 58,157,712 V9A probably damaging Het
Il4ra A T 7: 125,567,182 T33S possibly damaging Het
Ino80 A G 2: 119,418,409 V990A probably benign Het
Krtap4-9 T C 11: 99,785,570 probably benign Het
Lrrk2 A G 15: 91,779,981 I1974V possibly damaging Het
Mcm3ap C T 10: 76,471,160 A369V probably benign Het
Nek6 A G 2: 38,582,419 M252V probably benign Het
Nfasc T A 1: 132,610,839 I443F probably damaging Het
Nme8 T G 13: 19,697,036 M1L probably damaging Het
Npnt T A 3: 132,904,693 Q423L possibly damaging Het
Nup133 A T 8: 123,930,983 C404* probably null Het
Olfr1232 A G 2: 89,325,742 V146A probably benign Het
Olfr1307 A G 2: 111,944,859 V199A possibly damaging Het
Olfr1535 T C 13: 21,555,812 D70G probably damaging Het
Olfr262 T C 19: 12,241,659 M1V probably null Het
Olfr684 T C 7: 105,156,983 E233G probably benign Het
Olfr806 A G 10: 129,738,443 L158S probably damaging Het
Otog T A 7: 46,288,159 I1764N probably benign Het
Oxa1l A G 14: 54,363,452 I127M probably benign Het
P4hb C A 11: 120,572,726 V28F probably damaging Het
Pbld2 C T 10: 63,054,371 A186V probably benign Het
Pdzph1 G T 17: 58,974,813 T158K probably damaging Het
Pgm1 T A 5: 64,107,851 probably null Het
Phip A T 9: 82,876,189 S1484T probably benign Het
Pikfyve T C 1: 65,192,271 L100P probably damaging Het
Pikfyve T C 1: 65,246,370 S923P probably benign Het
Pla2g4e A G 2: 120,244,721 S63P probably benign Het
Plekhh2 A G 17: 84,599,265 E1176G probably damaging Het
Prlr T A 15: 10,325,318 Y192* probably null Het
Pten T A 19: 32,798,072 C71S probably damaging Het
Rbbp8nl A G 2: 180,281,194 L202P probably benign Het
Ripor2 T A 13: 24,701,254 S491T probably benign Het
Robo1 A T 16: 73,004,511 I1008F probably benign Het
Scg2 T C 1: 79,435,635 N417S probably benign Het
Scn8a A G 15: 101,039,615 I1581V probably damaging Het
Slc22a8 T A 19: 8,594,229 I108N probably damaging Het
Slc9a8 A T 2: 167,471,465 T416S possibly damaging Het
Spata32 T A 11: 103,208,818 E287V probably damaging Het
Spata5 T C 3: 37,439,185 F515L probably damaging Het
Tgfbrap1 C T 1: 43,075,352 G196D probably damaging Het
Tgm5 G T 2: 121,077,650 T15K possibly damaging Het
Tmc1 C T 19: 20,826,501 probably null Het
Tmem177 T C 1: 119,910,576 I124M possibly damaging Het
Trim30a A G 7: 104,435,901 F34S probably damaging Het
Tsn T C 1: 118,305,239 T112A probably benign Het
Tspyl5 T G 15: 33,686,776 N341T probably benign Het
Vmn2r108 C T 17: 20,469,073 C540Y probably damaging Het
Vrtn C T 12: 84,650,224 R583W probably damaging Het
Wnt1 T C 15: 98,791,757 S142P probably damaging Het
Wrn A T 8: 33,343,561 I108N probably damaging Het
Zfhx2 A C 14: 55,072,891 C733G possibly damaging Het
Zfp219 T C 14: 52,007,106 T539A probably damaging Het
Zswim8 T A 14: 20,711,530 M177K probably damaging Het
Other mutations in Cryzl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Cryzl2 APN 1 157470676 missense probably benign
IGL01481:Cryzl2 APN 1 157470739 unclassified probably null
IGL01878:Cryzl2 APN 1 157472400 missense possibly damaging 0.70
IGL02596:Cryzl2 APN 1 157464969 missense probably damaging 1.00
G5030:Cryzl2 UTSW 1 157465010 nonsense probably null
R0399:Cryzl2 UTSW 1 157462016 missense probably damaging 1.00
R0402:Cryzl2 UTSW 1 157464444 missense probably benign 0.00
R0518:Cryzl2 UTSW 1 157464430 missense probably damaging 1.00
R0761:Cryzl2 UTSW 1 157465724 missense probably benign 0.15
R1104:Cryzl2 UTSW 1 157470604 splice site probably benign
R1471:Cryzl2 UTSW 1 157470721 missense probably benign 0.01
R4752:Cryzl2 UTSW 1 157458649 splice site probably null
R5046:Cryzl2 UTSW 1 157465013 missense probably damaging 1.00
R5389:Cryzl2 UTSW 1 157461976 nonsense probably null
R5778:Cryzl2 UTSW 1 157470787 missense probably benign 0.00
R6928:Cryzl2 UTSW 1 157470787 missense probably benign 0.00
Z1088:Cryzl2 UTSW 1 157465789 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CAGTATGGCTCATGGTGGATGCTC -3'
(R):5'- TCTGAACAATGATCGCCCCAGGAC -3'

Sequencing Primer
(F):5'- CATGGTGGATGCTCATGGC -3'
(R):5'- TTGACGCTGATGCCTACAG -3'
Posted On2014-05-23