Incidental Mutation 'R1773:Ino80'
ID196781
Institutional Source Beutler Lab
Gene Symbol Ino80
Ensembl Gene ENSMUSG00000034154
Gene NameINO80 complex subunit
SynonymsINO80, 2310079N15Rik, 4632409L19Rik, Inoc1
MMRRC Submission 039804-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.978) question?
Stock #R1773 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119373042-119477687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119418409 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 990 (V990A)
Ref Sequence ENSEMBL: ENSMUSP00000051845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049920] [ENSMUST00000110808]
Predicted Effect probably benign
Transcript: ENSMUST00000049920
AA Change: V990A

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: V990A

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 275 407 6.6e-50 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
HELICc 1134 1217 2.86e-22 SMART
low complexity region 1270 1324 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1438 1450 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
low complexity region 1510 1521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110808
AA Change: V990A

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106431
Gene: ENSMUSG00000034154
AA Change: V990A

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 272 412 8.8e-55 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
PDB:3MWY|W 1098 1136 6e-7 PDB
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,580,595 K334E probably damaging Het
Abca12 A G 1: 71,288,596 Y1442H probably damaging Het
Acot12 A G 13: 91,757,557 T79A probably benign Het
Adipoq A C 16: 23,155,238 Q26P unknown Het
Akap13 T A 7: 75,683,451 N1582K possibly damaging Het
Alg9 A G 9: 50,779,096 T133A probably benign Het
Anks3 T C 16: 4,947,294 T418A probably benign Het
Ano3 A C 2: 110,761,455 L37R probably damaging Het
Ano9 A G 7: 141,108,378 F178L possibly damaging Het
Arhgef12 A G 9: 43,005,542 probably null Het
Arl16 T A 11: 120,465,763 I137F possibly damaging Het
Brpf1 T A 6: 113,319,931 S959T possibly damaging Het
C530008M17Rik G T 5: 76,867,205 A42S possibly damaging Het
Ccdc27 C T 4: 154,041,765 R89Q unknown Het
Cd109 A C 9: 78,703,724 Q1207H probably benign Het
Cd14 A T 18: 36,725,304 V366D possibly damaging Het
Cep290 G A 10: 100,510,573 V538I probably benign Het
Cep57 G A 9: 13,816,068 A202V probably damaging Het
Chl1 T C 6: 103,647,331 probably null Het
Cmah T G 13: 24,417,299 F29L probably benign Het
Crybg1 A G 10: 43,992,548 V1378A possibly damaging Het
Cryzl2 A G 1: 157,470,722 K227R probably benign Het
D130043K22Rik T G 13: 24,882,602 V794G possibly damaging Het
Ddx4 T A 13: 112,599,902 T645S probably benign Het
Dhcr7 C T 7: 143,847,458 R453C possibly damaging Het
Dhx8 T C 11: 101,752,363 Y754H possibly damaging Het
Dip2b T A 15: 100,193,961 D860E probably benign Het
Dnah7a T C 1: 53,432,887 probably null Het
Dst A G 1: 34,291,899 D6937G probably damaging Het
Dusp1 A G 17: 26,507,107 I204T probably damaging Het
Dync2h1 T A 9: 7,128,256 Q1859L probably damaging Het
E4f1 C A 17: 24,446,584 G328V probably damaging Het
Eml5 T C 12: 98,798,839 Y1617C probably damaging Het
Espn G T 4: 152,128,229 P622Q probably damaging Het
Fam184b G A 5: 45,584,334 P185L possibly damaging Het
Fam71f1 T C 6: 29,334,153 S335P possibly damaging Het
Fn1 T A 1: 71,637,383 D563V probably damaging Het
Gad2 A G 2: 22,690,207 Y540C probably benign Het
Gdf11 T C 10: 128,891,294 D131G probably damaging Het
Gm19965 T A 1: 116,821,259 Y223* probably null Het
H2-M10.6 A G 17: 36,812,184 K3R probably benign Het
Hid1 A G 11: 115,348,510 Y776H probably damaging Het
Hivep3 A T 4: 120,098,837 K1450I probably damaging Het
Icam5 T C 9: 21,033,525 L128P possibly damaging Het
Idnk T C 13: 58,157,712 V9A probably damaging Het
Il4ra A T 7: 125,567,182 T33S possibly damaging Het
Krtap4-9 T C 11: 99,785,570 probably benign Het
Lrrk2 A G 15: 91,779,981 I1974V possibly damaging Het
Mcm3ap C T 10: 76,471,160 A369V probably benign Het
Nek6 A G 2: 38,582,419 M252V probably benign Het
Nfasc T A 1: 132,610,839 I443F probably damaging Het
Nme8 T G 13: 19,697,036 M1L probably damaging Het
Npnt T A 3: 132,904,693 Q423L possibly damaging Het
Nup133 A T 8: 123,930,983 C404* probably null Het
Olfr1232 A G 2: 89,325,742 V146A probably benign Het
Olfr1307 A G 2: 111,944,859 V199A possibly damaging Het
Olfr1535 T C 13: 21,555,812 D70G probably damaging Het
Olfr262 T C 19: 12,241,659 M1V probably null Het
Olfr684 T C 7: 105,156,983 E233G probably benign Het
Olfr806 A G 10: 129,738,443 L158S probably damaging Het
Otog T A 7: 46,288,159 I1764N probably benign Het
Oxa1l A G 14: 54,363,452 I127M probably benign Het
P4hb C A 11: 120,572,726 V28F probably damaging Het
Pbld2 C T 10: 63,054,371 A186V probably benign Het
Pdzph1 G T 17: 58,974,813 T158K probably damaging Het
Pgm1 T A 5: 64,107,851 probably null Het
Phip A T 9: 82,876,189 S1484T probably benign Het
Pikfyve T C 1: 65,192,271 L100P probably damaging Het
Pikfyve T C 1: 65,246,370 S923P probably benign Het
Pla2g4e A G 2: 120,244,721 S63P probably benign Het
Plekhh2 A G 17: 84,599,265 E1176G probably damaging Het
Prlr T A 15: 10,325,318 Y192* probably null Het
Pten T A 19: 32,798,072 C71S probably damaging Het
Rbbp8nl A G 2: 180,281,194 L202P probably benign Het
Ripor2 T A 13: 24,701,254 S491T probably benign Het
Robo1 A T 16: 73,004,511 I1008F probably benign Het
Scg2 T C 1: 79,435,635 N417S probably benign Het
Scn8a A G 15: 101,039,615 I1581V probably damaging Het
Slc22a8 T A 19: 8,594,229 I108N probably damaging Het
Slc9a8 A T 2: 167,471,465 T416S possibly damaging Het
Spata32 T A 11: 103,208,818 E287V probably damaging Het
Spata5 T C 3: 37,439,185 F515L probably damaging Het
Tgfbrap1 C T 1: 43,075,352 G196D probably damaging Het
Tgm5 G T 2: 121,077,650 T15K possibly damaging Het
Tmc1 C T 19: 20,826,501 probably null Het
Tmem177 T C 1: 119,910,576 I124M possibly damaging Het
Trim30a A G 7: 104,435,901 F34S probably damaging Het
Tsn T C 1: 118,305,239 T112A probably benign Het
Tspyl5 T G 15: 33,686,776 N341T probably benign Het
Vmn2r108 C T 17: 20,469,073 C540Y probably damaging Het
Vrtn C T 12: 84,650,224 R583W probably damaging Het
Wnt1 T C 15: 98,791,757 S142P probably damaging Het
Wrn A T 8: 33,343,561 I108N probably damaging Het
Zfhx2 A C 14: 55,072,891 C733G possibly damaging Het
Zfp219 T C 14: 52,007,106 T539A probably damaging Het
Zswim8 T A 14: 20,711,530 M177K probably damaging Het
Other mutations in Ino80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01404:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01985:Ino80 APN 2 119433321 missense probably damaging 0.99
IGL02039:Ino80 APN 2 119380073 missense probably damaging 1.00
IGL02187:Ino80 APN 2 119445457 splice site probably benign
IGL02726:Ino80 APN 2 119442483 missense probably damaging 1.00
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0057:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0113:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0114:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0115:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0138:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0189:Ino80 UTSW 2 119379679 missense probably benign 0.36
R0363:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0364:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0365:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0481:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0532:Ino80 UTSW 2 119381983 missense possibly damaging 0.79
R0580:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R0610:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0675:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R1275:Ino80 UTSW 2 119427055 missense probably benign 0.12
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1506:Ino80 UTSW 2 119425265 nonsense probably null
R1510:Ino80 UTSW 2 119450049 missense probably damaging 1.00
R1570:Ino80 UTSW 2 119447028 missense possibly damaging 0.68
R1613:Ino80 UTSW 2 119392867 missense probably damaging 1.00
R1673:Ino80 UTSW 2 119381936 missense probably damaging 1.00
R1795:Ino80 UTSW 2 119406859 missense probably damaging 1.00
R2093:Ino80 UTSW 2 119426670 missense possibly damaging 0.55
R2105:Ino80 UTSW 2 119431929 missense probably null 1.00
R2113:Ino80 UTSW 2 119454084 missense probably damaging 1.00
R3618:Ino80 UTSW 2 119446872 missense probably null 0.81
R4572:Ino80 UTSW 2 119402358 missense probably damaging 1.00
R4649:Ino80 UTSW 2 119431008 missense probably damaging 1.00
R4919:Ino80 UTSW 2 119442592 missense probably damaging 1.00
R5113:Ino80 UTSW 2 119431945 missense probably damaging 1.00
R5138:Ino80 UTSW 2 119383421 missense probably damaging 1.00
R5458:Ino80 UTSW 2 119412429 missense possibly damaging 0.50
R5499:Ino80 UTSW 2 119441647 missense probably damaging 1.00
R5502:Ino80 UTSW 2 119402396 missense probably damaging 1.00
R5531:Ino80 UTSW 2 119445575 missense probably benign
R5740:Ino80 UTSW 2 119431029 missense probably damaging 1.00
R5892:Ino80 UTSW 2 119439547 intron probably benign
R5914:Ino80 UTSW 2 119458216 missense probably damaging 0.99
R6000:Ino80 UTSW 2 119374508 missense probably benign 0.04
R6263:Ino80 UTSW 2 119383414 missense probably damaging 1.00
R6505:Ino80 UTSW 2 119451441 missense probably damaging 1.00
R6942:Ino80 UTSW 2 119383502 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAAACTGTCCCTTGAGTACTAGCTCAT -3'
(R):5'- GGCTAAAGAGAGGTTGTTTCCTGTTCAT -3'

Sequencing Primer
(F):5'- TGAGTACTAGCTCATTCTTACAGG -3'
(R):5'- gggccatcaaagggtacac -3'
Posted On2014-05-23