Incidental Mutation 'R1773:Spata5'
ID196786
Institutional Source Beutler Lab
Gene Symbol Spata5
Ensembl Gene ENSMUSG00000027722
Gene Namespermatogenesis associated 5
SynonymsC78064, 2510048F20Rik, Spaf
MMRRC Submission 039804-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.980) question?
Stock #R1773 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location37419896-37579096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37439185 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 515 (F515L)
Ref Sequence ENSEMBL: ENSMUSP00000103747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029277] [ENSMUST00000108112] [ENSMUST00000198968]
Predicted Effect probably damaging
Transcript: ENSMUST00000029277
AA Change: F514L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029277
Gene: ENSMUSG00000027722
AA Change: F514L

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
CDC48_N 44 135 2.47e-1 SMART
low complexity region 276 287 N/A INTRINSIC
AAA 385 524 4.96e-21 SMART
Blast:AAA 553 622 9e-21 BLAST
AAA 659 797 2.48e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108112
AA Change: F515L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103747
Gene: ENSMUSG00000027722
AA Change: F515L

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
CDC48_N 44 136 1.14e0 SMART
low complexity region 277 288 N/A INTRINSIC
AAA 386 525 4.96e-21 SMART
Blast:AAA 554 623 9e-21 BLAST
AAA 660 798 2.48e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142199
Predicted Effect probably damaging
Transcript: ENSMUST00000198968
AA Change: F515L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143349
Gene: ENSMUSG00000027722
AA Change: F515L

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
CDC48_N 44 136 8.6e-5 SMART
low complexity region 277 288 N/A INTRINSIC
AAA 386 525 8.2e-23 SMART
Blast:AAA 554 623 7e-21 BLAST
AAA 660 798 4e-23 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ATPase associated with diverse activities family, whose members are defined by a highly conserved ATPase domain. Members of this family participate in diverse cellular processes that include membrane fusion, DNA replication, microtubule severing, and protein degradation. The protein encoded by this gene has a putative mitochondrial targeting sequence and has been proposed to function in maintenance of mitochondrial function and integrity during mouse spermatogenesis. Allelic variants in this gene have been associated with epilepsy, hearing loss, and mental retardation syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,580,595 K334E probably damaging Het
Abca12 A G 1: 71,288,596 Y1442H probably damaging Het
Acot12 A G 13: 91,757,557 T79A probably benign Het
Adipoq A C 16: 23,155,238 Q26P unknown Het
Akap13 T A 7: 75,683,451 N1582K possibly damaging Het
Alg9 A G 9: 50,779,096 T133A probably benign Het
Anks3 T C 16: 4,947,294 T418A probably benign Het
Ano3 A C 2: 110,761,455 L37R probably damaging Het
Ano9 A G 7: 141,108,378 F178L possibly damaging Het
Arhgef12 A G 9: 43,005,542 probably null Het
Arl16 T A 11: 120,465,763 I137F possibly damaging Het
Brpf1 T A 6: 113,319,931 S959T possibly damaging Het
C530008M17Rik G T 5: 76,867,205 A42S possibly damaging Het
Ccdc27 C T 4: 154,041,765 R89Q unknown Het
Cd109 A C 9: 78,703,724 Q1207H probably benign Het
Cd14 A T 18: 36,725,304 V366D possibly damaging Het
Cep290 G A 10: 100,510,573 V538I probably benign Het
Cep57 G A 9: 13,816,068 A202V probably damaging Het
Chl1 T C 6: 103,647,331 probably null Het
Cmah T G 13: 24,417,299 F29L probably benign Het
Crybg1 A G 10: 43,992,548 V1378A possibly damaging Het
Cryzl2 A G 1: 157,470,722 K227R probably benign Het
D130043K22Rik T G 13: 24,882,602 V794G possibly damaging Het
Ddx4 T A 13: 112,599,902 T645S probably benign Het
Dhcr7 C T 7: 143,847,458 R453C possibly damaging Het
Dhx8 T C 11: 101,752,363 Y754H possibly damaging Het
Dip2b T A 15: 100,193,961 D860E probably benign Het
Dnah7a T C 1: 53,432,887 probably null Het
Dst A G 1: 34,291,899 D6937G probably damaging Het
Dusp1 A G 17: 26,507,107 I204T probably damaging Het
Dync2h1 T A 9: 7,128,256 Q1859L probably damaging Het
E4f1 C A 17: 24,446,584 G328V probably damaging Het
Eml5 T C 12: 98,798,839 Y1617C probably damaging Het
Espn G T 4: 152,128,229 P622Q probably damaging Het
Fam184b G A 5: 45,584,334 P185L possibly damaging Het
Fam71f1 T C 6: 29,334,153 S335P possibly damaging Het
Fn1 T A 1: 71,637,383 D563V probably damaging Het
Gad2 A G 2: 22,690,207 Y540C probably benign Het
Gdf11 T C 10: 128,891,294 D131G probably damaging Het
Gm19965 T A 1: 116,821,259 Y223* probably null Het
H2-M10.6 A G 17: 36,812,184 K3R probably benign Het
Hid1 A G 11: 115,348,510 Y776H probably damaging Het
Hivep3 A T 4: 120,098,837 K1450I probably damaging Het
Icam5 T C 9: 21,033,525 L128P possibly damaging Het
Idnk T C 13: 58,157,712 V9A probably damaging Het
Il4ra A T 7: 125,567,182 T33S possibly damaging Het
Ino80 A G 2: 119,418,409 V990A probably benign Het
Krtap4-9 T C 11: 99,785,570 probably benign Het
Lrrk2 A G 15: 91,779,981 I1974V possibly damaging Het
Mcm3ap C T 10: 76,471,160 A369V probably benign Het
Nek6 A G 2: 38,582,419 M252V probably benign Het
Nfasc T A 1: 132,610,839 I443F probably damaging Het
Nme8 T G 13: 19,697,036 M1L probably damaging Het
Npnt T A 3: 132,904,693 Q423L possibly damaging Het
Nup133 A T 8: 123,930,983 C404* probably null Het
Olfr1232 A G 2: 89,325,742 V146A probably benign Het
Olfr1307 A G 2: 111,944,859 V199A possibly damaging Het
Olfr1535 T C 13: 21,555,812 D70G probably damaging Het
Olfr262 T C 19: 12,241,659 M1V probably null Het
Olfr684 T C 7: 105,156,983 E233G probably benign Het
Olfr806 A G 10: 129,738,443 L158S probably damaging Het
Otog T A 7: 46,288,159 I1764N probably benign Het
Oxa1l A G 14: 54,363,452 I127M probably benign Het
P4hb C A 11: 120,572,726 V28F probably damaging Het
Pbld2 C T 10: 63,054,371 A186V probably benign Het
Pdzph1 G T 17: 58,974,813 T158K probably damaging Het
Pgm1 T A 5: 64,107,851 probably null Het
Phip A T 9: 82,876,189 S1484T probably benign Het
Pikfyve T C 1: 65,192,271 L100P probably damaging Het
Pikfyve T C 1: 65,246,370 S923P probably benign Het
Pla2g4e A G 2: 120,244,721 S63P probably benign Het
Plekhh2 A G 17: 84,599,265 E1176G probably damaging Het
Prlr T A 15: 10,325,318 Y192* probably null Het
Pten T A 19: 32,798,072 C71S probably damaging Het
Rbbp8nl A G 2: 180,281,194 L202P probably benign Het
Ripor2 T A 13: 24,701,254 S491T probably benign Het
Robo1 A T 16: 73,004,511 I1008F probably benign Het
Scg2 T C 1: 79,435,635 N417S probably benign Het
Scn8a A G 15: 101,039,615 I1581V probably damaging Het
Slc22a8 T A 19: 8,594,229 I108N probably damaging Het
Slc9a8 A T 2: 167,471,465 T416S possibly damaging Het
Spata32 T A 11: 103,208,818 E287V probably damaging Het
Tgfbrap1 C T 1: 43,075,352 G196D probably damaging Het
Tgm5 G T 2: 121,077,650 T15K possibly damaging Het
Tmc1 C T 19: 20,826,501 probably null Het
Tmem177 T C 1: 119,910,576 I124M possibly damaging Het
Trim30a A G 7: 104,435,901 F34S probably damaging Het
Tsn T C 1: 118,305,239 T112A probably benign Het
Tspyl5 T G 15: 33,686,776 N341T probably benign Het
Vmn2r108 C T 17: 20,469,073 C540Y probably damaging Het
Vrtn C T 12: 84,650,224 R583W probably damaging Het
Wnt1 T C 15: 98,791,757 S142P probably damaging Het
Wrn A T 8: 33,343,561 I108N probably damaging Het
Zfhx2 A C 14: 55,072,891 C733G possibly damaging Het
Zfp219 T C 14: 52,007,106 T539A probably damaging Het
Zswim8 T A 14: 20,711,530 M177K probably damaging Het
Other mutations in Spata5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Spata5 APN 3 37451802 missense possibly damaging 0.60
IGL00472:Spata5 APN 3 37436644 missense probably benign
IGL02664:Spata5 APN 3 37436665 missense probably damaging 1.00
IGL02797:Spata5 APN 3 37458316 splice site probably benign
IGL02869:Spata5 APN 3 37464545 missense probably damaging 1.00
IGL02891:Spata5 APN 3 37426192 missense probably damaging 0.97
IGL03065:Spata5 APN 3 37432179 missense possibly damaging 0.75
IGL03121:Spata5 APN 3 37464651 missense probably damaging 1.00
IGL03178:Spata5 APN 3 37578783 missense probably damaging 1.00
R0494:Spata5 UTSW 3 37432163 missense possibly damaging 0.79
R0621:Spata5 UTSW 3 37432029 missense probably benign 0.06
R0908:Spata5 UTSW 3 37431623 splice site probably null
R2016:Spata5 UTSW 3 37578762 missense possibly damaging 0.48
R3714:Spata5 UTSW 3 37433209 missense probably benign
R3836:Spata5 UTSW 3 37433643 missense possibly damaging 0.91
R4548:Spata5 UTSW 3 37432027 missense probably benign 0.03
R4695:Spata5 UTSW 3 37458325 missense probably damaging 1.00
R4758:Spata5 UTSW 3 37433236 missense probably benign 0.01
R5009:Spata5 UTSW 3 37433277 splice site probably benign
R5839:Spata5 UTSW 3 37464654 missense probably damaging 1.00
R6437:Spata5 UTSW 3 37528198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ccactgcctggctAAAGTTAATAAATGTCT -3'
(R):5'- ACCTGCCTCATTACACAACGCTTTC -3'

Sequencing Primer
(F):5'- aaatccacctgtctctgcc -3'
(R):5'- TACACAACGCTTTCAAGTCTG -3'
Posted On2014-05-23