Incidental Mutation 'R1773:Nup133'
ID196820
Institutional Source Beutler Lab
Gene Symbol Nup133
Ensembl Gene ENSMUSG00000039509
Gene Namenucleoporin 133
Synonymsmermaid, 4832420O05Rik
MMRRC Submission 039804-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1773 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123897123-123949265 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 123930983 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 404 (C404*)
Ref Sequence ENSEMBL: ENSMUSP00000048084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]
Predicted Effect probably null
Transcript: ENSMUST00000044795
AA Change: C404*
SMART Domains Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509
AA Change: C404*

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
PDB:1XKS|A 66 513 N/A PDB
Pfam:Nucleoporin_C 593 1052 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212133
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,580,595 K334E probably damaging Het
Abca12 A G 1: 71,288,596 Y1442H probably damaging Het
Acot12 A G 13: 91,757,557 T79A probably benign Het
Adipoq A C 16: 23,155,238 Q26P unknown Het
Akap13 T A 7: 75,683,451 N1582K possibly damaging Het
Alg9 A G 9: 50,779,096 T133A probably benign Het
Anks3 T C 16: 4,947,294 T418A probably benign Het
Ano3 A C 2: 110,761,455 L37R probably damaging Het
Ano9 A G 7: 141,108,378 F178L possibly damaging Het
Arhgef12 A G 9: 43,005,542 probably null Het
Arl16 T A 11: 120,465,763 I137F possibly damaging Het
Brpf1 T A 6: 113,319,931 S959T possibly damaging Het
C530008M17Rik G T 5: 76,867,205 A42S possibly damaging Het
Ccdc27 C T 4: 154,041,765 R89Q unknown Het
Cd109 A C 9: 78,703,724 Q1207H probably benign Het
Cd14 A T 18: 36,725,304 V366D possibly damaging Het
Cep290 G A 10: 100,510,573 V538I probably benign Het
Cep57 G A 9: 13,816,068 A202V probably damaging Het
Chl1 T C 6: 103,647,331 probably null Het
Cmah T G 13: 24,417,299 F29L probably benign Het
Crybg1 A G 10: 43,992,548 V1378A possibly damaging Het
Cryzl2 A G 1: 157,470,722 K227R probably benign Het
D130043K22Rik T G 13: 24,882,602 V794G possibly damaging Het
Ddx4 T A 13: 112,599,902 T645S probably benign Het
Dhcr7 C T 7: 143,847,458 R453C possibly damaging Het
Dhx8 T C 11: 101,752,363 Y754H possibly damaging Het
Dip2b T A 15: 100,193,961 D860E probably benign Het
Dnah7a T C 1: 53,432,887 probably null Het
Dst A G 1: 34,291,899 D6937G probably damaging Het
Dusp1 A G 17: 26,507,107 I204T probably damaging Het
Dync2h1 T A 9: 7,128,256 Q1859L probably damaging Het
E4f1 C A 17: 24,446,584 G328V probably damaging Het
Eml5 T C 12: 98,798,839 Y1617C probably damaging Het
Espn G T 4: 152,128,229 P622Q probably damaging Het
Fam184b G A 5: 45,584,334 P185L possibly damaging Het
Fam71f1 T C 6: 29,334,153 S335P possibly damaging Het
Fn1 T A 1: 71,637,383 D563V probably damaging Het
Gad2 A G 2: 22,690,207 Y540C probably benign Het
Gdf11 T C 10: 128,891,294 D131G probably damaging Het
Gm19965 T A 1: 116,821,259 Y223* probably null Het
H2-M10.6 A G 17: 36,812,184 K3R probably benign Het
Hid1 A G 11: 115,348,510 Y776H probably damaging Het
Hivep3 A T 4: 120,098,837 K1450I probably damaging Het
Icam5 T C 9: 21,033,525 L128P possibly damaging Het
Idnk T C 13: 58,157,712 V9A probably damaging Het
Il4ra A T 7: 125,567,182 T33S possibly damaging Het
Ino80 A G 2: 119,418,409 V990A probably benign Het
Krtap4-9 T C 11: 99,785,570 probably benign Het
Lrrk2 A G 15: 91,779,981 I1974V possibly damaging Het
Mcm3ap C T 10: 76,471,160 A369V probably benign Het
Nek6 A G 2: 38,582,419 M252V probably benign Het
Nfasc T A 1: 132,610,839 I443F probably damaging Het
Nme8 T G 13: 19,697,036 M1L probably damaging Het
Npnt T A 3: 132,904,693 Q423L possibly damaging Het
Olfr1232 A G 2: 89,325,742 V146A probably benign Het
Olfr1307 A G 2: 111,944,859 V199A possibly damaging Het
Olfr1535 T C 13: 21,555,812 D70G probably damaging Het
Olfr262 T C 19: 12,241,659 M1V probably null Het
Olfr684 T C 7: 105,156,983 E233G probably benign Het
Olfr806 A G 10: 129,738,443 L158S probably damaging Het
Otog T A 7: 46,288,159 I1764N probably benign Het
Oxa1l A G 14: 54,363,452 I127M probably benign Het
P4hb C A 11: 120,572,726 V28F probably damaging Het
Pbld2 C T 10: 63,054,371 A186V probably benign Het
Pdzph1 G T 17: 58,974,813 T158K probably damaging Het
Pgm1 T A 5: 64,107,851 probably null Het
Phip A T 9: 82,876,189 S1484T probably benign Het
Pikfyve T C 1: 65,192,271 L100P probably damaging Het
Pikfyve T C 1: 65,246,370 S923P probably benign Het
Pla2g4e A G 2: 120,244,721 S63P probably benign Het
Plekhh2 A G 17: 84,599,265 E1176G probably damaging Het
Prlr T A 15: 10,325,318 Y192* probably null Het
Pten T A 19: 32,798,072 C71S probably damaging Het
Rbbp8nl A G 2: 180,281,194 L202P probably benign Het
Ripor2 T A 13: 24,701,254 S491T probably benign Het
Robo1 A T 16: 73,004,511 I1008F probably benign Het
Scg2 T C 1: 79,435,635 N417S probably benign Het
Scn8a A G 15: 101,039,615 I1581V probably damaging Het
Slc22a8 T A 19: 8,594,229 I108N probably damaging Het
Slc9a8 A T 2: 167,471,465 T416S possibly damaging Het
Spata32 T A 11: 103,208,818 E287V probably damaging Het
Spata5 T C 3: 37,439,185 F515L probably damaging Het
Tgfbrap1 C T 1: 43,075,352 G196D probably damaging Het
Tgm5 G T 2: 121,077,650 T15K possibly damaging Het
Tmc1 C T 19: 20,826,501 probably null Het
Tmem177 T C 1: 119,910,576 I124M possibly damaging Het
Trim30a A G 7: 104,435,901 F34S probably damaging Het
Tsn T C 1: 118,305,239 T112A probably benign Het
Tspyl5 T G 15: 33,686,776 N341T probably benign Het
Vmn2r108 C T 17: 20,469,073 C540Y probably damaging Het
Vrtn C T 12: 84,650,224 R583W probably damaging Het
Wnt1 T C 15: 98,791,757 S142P probably damaging Het
Wrn A T 8: 33,343,561 I108N probably damaging Het
Zfhx2 A C 14: 55,072,891 C733G possibly damaging Het
Zfp219 T C 14: 52,007,106 T539A probably damaging Het
Zswim8 T A 14: 20,711,530 M177K probably damaging Het
Other mutations in Nup133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Nup133 APN 8 123939083 missense probably damaging 0.98
IGL00507:Nup133 APN 8 123918967 nonsense probably null
IGL00585:Nup133 APN 8 123909994 missense probably damaging 1.00
IGL00676:Nup133 APN 8 123906298 intron probably benign
IGL00966:Nup133 APN 8 123911906 missense probably damaging 0.98
IGL01069:Nup133 APN 8 123930982 nonsense probably null
IGL01553:Nup133 APN 8 123915324 missense possibly damaging 0.58
IGL01669:Nup133 APN 8 123939130 nonsense probably null
IGL01730:Nup133 APN 8 123938233 missense probably benign 0.00
IGL01996:Nup133 APN 8 123946595 missense probably benign 0.00
IGL02332:Nup133 APN 8 123907832 missense probably damaging 1.00
IGL02552:Nup133 APN 8 123929255 missense possibly damaging 0.75
IGL02956:Nup133 APN 8 123949083 missense probably benign 0.00
IGL03009:Nup133 APN 8 123933500 missense possibly damaging 0.46
IGL03036:Nup133 APN 8 123946594 missense probably benign 0.11
Slant UTSW 8 123916281 splice site probably null
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0139:Nup133 UTSW 8 123929343 missense probably benign 0.00
R0344:Nup133 UTSW 8 123917446 missense possibly damaging 0.82
R0730:Nup133 UTSW 8 123949008 missense probably benign 0.00
R1301:Nup133 UTSW 8 123917417 intron probably benign
R1453:Nup133 UTSW 8 123915375 missense probably benign 0.00
R1570:Nup133 UTSW 8 123949176 start codon destroyed possibly damaging 0.82
R1607:Nup133 UTSW 8 123949035 missense probably benign 0.02
R1992:Nup133 UTSW 8 123906221 missense possibly damaging 0.80
R2062:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2065:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2066:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2068:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R4397:Nup133 UTSW 8 123944301 missense probably benign 0.04
R4683:Nup133 UTSW 8 123930982 nonsense probably null
R4771:Nup133 UTSW 8 123929398 missense probably damaging 1.00
R4910:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4911:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4968:Nup133 UTSW 8 123915196 missense probably benign 0.07
R5411:Nup133 UTSW 8 123927206 missense probably benign
R5470:Nup133 UTSW 8 123930966 missense probably benign 0.00
R5664:Nup133 UTSW 8 123906281 missense probably benign 0.01
R5907:Nup133 UTSW 8 123916299 missense possibly damaging 0.90
R6003:Nup133 UTSW 8 123938292 missense probably damaging 0.98
R6059:Nup133 UTSW 8 123914596 missense probably damaging 1.00
R6219:Nup133 UTSW 8 123936873 missense possibly damaging 0.90
R6292:Nup133 UTSW 8 123917437 missense probably benign 0.01
R6672:Nup133 UTSW 8 123916281 splice site probably null
R6737:Nup133 UTSW 8 123906291 missense probably damaging 0.99
R6763:Nup133 UTSW 8 123944278 missense possibly damaging 0.95
R6870:Nup133 UTSW 8 123899507 missense probably benign 0.08
R6975:Nup133 UTSW 8 123915318 missense probably damaging 0.99
X0023:Nup133 UTSW 8 123909988 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGGAGTTCAGAATGTGACATGTGC -3'
(R):5'- CAGGCAGTCGCAGGGATTATAAACC -3'

Sequencing Primer
(F):5'- GCATAGGACTGACTGAATTCTGAC -3'
(R):5'- CCTGTCTATGAACCATCTGTGTAGTG -3'
Posted On2014-05-23