Incidental Mutation 'R1773:Mcm3ap'
ID196830
Institutional Source Beutler Lab
Gene Symbol Mcm3ap
Ensembl Gene ENSMUSG00000001150
Gene Nameminichromosome maintenance complex component 3 associated protein
SynonymsGANP
MMRRC Submission 039804-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1773 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location76468927-76515857 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76471160 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 369 (A369V)
Ref Sequence ENSEMBL: ENSMUSP00000125960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049185] [ENSMUST00000170795]
Predicted Effect probably benign
Transcript: ENSMUST00000049185
SMART Domains Protein: ENSMUSP00000045647
Gene: ENSMUSG00000033126

DomainStartEndE-ValueType
Pfam:UPF0054 8 148 7.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170795
AA Change: A369V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125960
Gene: ENSMUSG00000001150
AA Change: A369V

DomainStartEndE-ValueType
Pfam:NupH_GANP 2 286 3.3e-108 PFAM
low complexity region 389 403 N/A INTRINSIC
Blast:RRM 430 504 5e-39 BLAST
SCOP:d1fjeb2 434 500 6e-4 SMART
low complexity region 544 559 N/A INTRINSIC
low complexity region 570 586 N/A INTRINSIC
Pfam:SAC3_GANP 677 903 1.7e-82 PFAM
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1024 1035 N/A INTRINSIC
low complexity region 1039 1053 N/A INTRINSIC
low complexity region 1091 1110 N/A INTRINSIC
low complexity region 1133 1155 N/A INTRINSIC
Pfam:CID_GANP 1156 1226 1.6e-33 PFAM
Pfam:MCM3AP_GANP 1254 1967 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218564
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The minichromosome maintenance protein 3 (MCM3) is one of the MCM proteins essential for the initiation of DNA replication. The protein encoded by this gene is a MCM3 binding protein. It was reported to have phosphorylation-dependent DNA-primase activity, which was up-regulated in antigen immunization induced germinal center. This protein was demonstrated to be an acetyltransferase that acetylates MCM3 and plays a role in DNA replication. The mutagenesis of a nuclear localization signal of MCM3 affects the binding of this protein with MCM3, suggesting that this protein may also facilitate MCM3 nuclear localization. This gene is expressed in the brain or in neuronal tissue. An allelic variant encoding amino acid Lys at 915, instead of conserved Glu, has been identified in patients with mild intellectual disability. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele die by E12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,580,595 K334E probably damaging Het
Abca12 A G 1: 71,288,596 Y1442H probably damaging Het
Acot12 A G 13: 91,757,557 T79A probably benign Het
Adipoq A C 16: 23,155,238 Q26P unknown Het
Akap13 T A 7: 75,683,451 N1582K possibly damaging Het
Alg9 A G 9: 50,779,096 T133A probably benign Het
Anks3 T C 16: 4,947,294 T418A probably benign Het
Ano3 A C 2: 110,761,455 L37R probably damaging Het
Ano9 A G 7: 141,108,378 F178L possibly damaging Het
Arhgef12 A G 9: 43,005,542 probably null Het
Arl16 T A 11: 120,465,763 I137F possibly damaging Het
Brpf1 T A 6: 113,319,931 S959T possibly damaging Het
C530008M17Rik G T 5: 76,867,205 A42S possibly damaging Het
Ccdc27 C T 4: 154,041,765 R89Q unknown Het
Cd109 A C 9: 78,703,724 Q1207H probably benign Het
Cd14 A T 18: 36,725,304 V366D possibly damaging Het
Cep290 G A 10: 100,510,573 V538I probably benign Het
Cep57 G A 9: 13,816,068 A202V probably damaging Het
Chl1 T C 6: 103,647,331 probably null Het
Cmah T G 13: 24,417,299 F29L probably benign Het
Crybg1 A G 10: 43,992,548 V1378A possibly damaging Het
Cryzl2 A G 1: 157,470,722 K227R probably benign Het
D130043K22Rik T G 13: 24,882,602 V794G possibly damaging Het
Ddx4 T A 13: 112,599,902 T645S probably benign Het
Dhcr7 C T 7: 143,847,458 R453C possibly damaging Het
Dhx8 T C 11: 101,752,363 Y754H possibly damaging Het
Dip2b T A 15: 100,193,961 D860E probably benign Het
Dnah7a T C 1: 53,432,887 probably null Het
Dst A G 1: 34,291,899 D6937G probably damaging Het
Dusp1 A G 17: 26,507,107 I204T probably damaging Het
Dync2h1 T A 9: 7,128,256 Q1859L probably damaging Het
E4f1 C A 17: 24,446,584 G328V probably damaging Het
Eml5 T C 12: 98,798,839 Y1617C probably damaging Het
Espn G T 4: 152,128,229 P622Q probably damaging Het
Fam184b G A 5: 45,584,334 P185L possibly damaging Het
Fam71f1 T C 6: 29,334,153 S335P possibly damaging Het
Fn1 T A 1: 71,637,383 D563V probably damaging Het
Gad2 A G 2: 22,690,207 Y540C probably benign Het
Gdf11 T C 10: 128,891,294 D131G probably damaging Het
Gm19965 T A 1: 116,821,259 Y223* probably null Het
H2-M10.6 A G 17: 36,812,184 K3R probably benign Het
Hid1 A G 11: 115,348,510 Y776H probably damaging Het
Hivep3 A T 4: 120,098,837 K1450I probably damaging Het
Icam5 T C 9: 21,033,525 L128P possibly damaging Het
Idnk T C 13: 58,157,712 V9A probably damaging Het
Il4ra A T 7: 125,567,182 T33S possibly damaging Het
Ino80 A G 2: 119,418,409 V990A probably benign Het
Krtap4-9 T C 11: 99,785,570 probably benign Het
Lrrk2 A G 15: 91,779,981 I1974V possibly damaging Het
Nek6 A G 2: 38,582,419 M252V probably benign Het
Nfasc T A 1: 132,610,839 I443F probably damaging Het
Nme8 T G 13: 19,697,036 M1L probably damaging Het
Npnt T A 3: 132,904,693 Q423L possibly damaging Het
Nup133 A T 8: 123,930,983 C404* probably null Het
Olfr1232 A G 2: 89,325,742 V146A probably benign Het
Olfr1307 A G 2: 111,944,859 V199A possibly damaging Het
Olfr1535 T C 13: 21,555,812 D70G probably damaging Het
Olfr262 T C 19: 12,241,659 M1V probably null Het
Olfr684 T C 7: 105,156,983 E233G probably benign Het
Olfr806 A G 10: 129,738,443 L158S probably damaging Het
Otog T A 7: 46,288,159 I1764N probably benign Het
Oxa1l A G 14: 54,363,452 I127M probably benign Het
P4hb C A 11: 120,572,726 V28F probably damaging Het
Pbld2 C T 10: 63,054,371 A186V probably benign Het
Pdzph1 G T 17: 58,974,813 T158K probably damaging Het
Pgm1 T A 5: 64,107,851 probably null Het
Phip A T 9: 82,876,189 S1484T probably benign Het
Pikfyve T C 1: 65,192,271 L100P probably damaging Het
Pikfyve T C 1: 65,246,370 S923P probably benign Het
Pla2g4e A G 2: 120,244,721 S63P probably benign Het
Plekhh2 A G 17: 84,599,265 E1176G probably damaging Het
Prlr T A 15: 10,325,318 Y192* probably null Het
Pten T A 19: 32,798,072 C71S probably damaging Het
Rbbp8nl A G 2: 180,281,194 L202P probably benign Het
Ripor2 T A 13: 24,701,254 S491T probably benign Het
Robo1 A T 16: 73,004,511 I1008F probably benign Het
Scg2 T C 1: 79,435,635 N417S probably benign Het
Scn8a A G 15: 101,039,615 I1581V probably damaging Het
Slc22a8 T A 19: 8,594,229 I108N probably damaging Het
Slc9a8 A T 2: 167,471,465 T416S possibly damaging Het
Spata32 T A 11: 103,208,818 E287V probably damaging Het
Spata5 T C 3: 37,439,185 F515L probably damaging Het
Tgfbrap1 C T 1: 43,075,352 G196D probably damaging Het
Tgm5 G T 2: 121,077,650 T15K possibly damaging Het
Tmc1 C T 19: 20,826,501 probably null Het
Tmem177 T C 1: 119,910,576 I124M possibly damaging Het
Trim30a A G 7: 104,435,901 F34S probably damaging Het
Tsn T C 1: 118,305,239 T112A probably benign Het
Tspyl5 T G 15: 33,686,776 N341T probably benign Het
Vmn2r108 C T 17: 20,469,073 C540Y probably damaging Het
Vrtn C T 12: 84,650,224 R583W probably damaging Het
Wnt1 T C 15: 98,791,757 S142P probably damaging Het
Wrn A T 8: 33,343,561 I108N probably damaging Het
Zfhx2 A C 14: 55,072,891 C733G possibly damaging Het
Zfp219 T C 14: 52,007,106 T539A probably damaging Het
Zswim8 T A 14: 20,711,530 M177K probably damaging Het
Other mutations in Mcm3ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Mcm3ap APN 10 76471177 missense probably benign 0.01
IGL00742:Mcm3ap APN 10 76492935 missense probably damaging 1.00
IGL00898:Mcm3ap APN 10 76470325 missense probably benign 0.00
IGL00984:Mcm3ap APN 10 76499566 missense probably damaging 1.00
IGL01591:Mcm3ap APN 10 76470805 missense probably benign
IGL01882:Mcm3ap APN 10 76483184 missense possibly damaging 0.71
IGL01973:Mcm3ap APN 10 76471117 missense probably benign 0.00
IGL02253:Mcm3ap APN 10 76470065 missense probably benign 0.40
IGL02304:Mcm3ap APN 10 76484738 missense possibly damaging 0.65
IGL02340:Mcm3ap APN 10 76496552 nonsense probably null
IGL02487:Mcm3ap APN 10 76507555 unclassified probably benign
IGL02488:Mcm3ap APN 10 76499649 missense probably damaging 1.00
IGL02640:Mcm3ap APN 10 76506421 missense probably damaging 1.00
IGL02714:Mcm3ap APN 10 76511033 missense probably benign 0.00
IGL02748:Mcm3ap APN 10 76501248 missense probably damaging 1.00
IGL02894:Mcm3ap APN 10 76477767 missense probably benign 0.00
IGL02903:Mcm3ap APN 10 76471258 splice site probably benign
IGL02955:Mcm3ap APN 10 76507466 missense probably benign 0.34
IGL02989:Mcm3ap APN 10 76471060 missense possibly damaging 0.48
IGL03003:Mcm3ap APN 10 76504697 missense probably benign 0.01
IGL03081:Mcm3ap APN 10 76470316 missense possibly damaging 0.86
IGL03218:Mcm3ap APN 10 76482733 missense probably damaging 1.00
IGL03401:Mcm3ap APN 10 76484649 splice site probably benign
psychopomp UTSW 10 76501100 missense probably damaging 0.97
R0105:Mcm3ap UTSW 10 76499534 missense probably damaging 1.00
R0144:Mcm3ap UTSW 10 76481015 missense probably benign 0.44
R0423:Mcm3ap UTSW 10 76502705 missense probably benign 0.00
R0692:Mcm3ap UTSW 10 76483169 missense probably damaging 1.00
R1402:Mcm3ap UTSW 10 76477914 unclassified probably benign
R1441:Mcm3ap UTSW 10 76471166 missense probably benign
R1512:Mcm3ap UTSW 10 76470513 missense probably damaging 1.00
R1533:Mcm3ap UTSW 10 76504287 missense probably damaging 1.00
R1569:Mcm3ap UTSW 10 76483188 missense possibly damaging 0.80
R1590:Mcm3ap UTSW 10 76496541 missense probably benign 0.36
R1597:Mcm3ap UTSW 10 76483226 missense probably damaging 1.00
R1743:Mcm3ap UTSW 10 76484674 missense possibly damaging 0.53
R1922:Mcm3ap UTSW 10 76507361 missense probably damaging 1.00
R2061:Mcm3ap UTSW 10 76470068 missense probably benign 0.43
R2097:Mcm3ap UTSW 10 76512489 missense probably damaging 1.00
R2436:Mcm3ap UTSW 10 76490057 missense probably damaging 1.00
R3684:Mcm3ap UTSW 10 76489426 missense possibly damaging 0.64
R3690:Mcm3ap UTSW 10 76482679 missense probably damaging 1.00
R3881:Mcm3ap UTSW 10 76506446 missense probably benign 0.21
R4296:Mcm3ap UTSW 10 76507337 missense probably damaging 1.00
R4677:Mcm3ap UTSW 10 76470570 missense probably damaging 1.00
R4786:Mcm3ap UTSW 10 76488466 missense probably benign 0.00
R4882:Mcm3ap UTSW 10 76484661 nonsense probably null
R4907:Mcm3ap UTSW 10 76493441 missense probably damaging 1.00
R5108:Mcm3ap UTSW 10 76502702 missense probably benign 0.04
R5279:Mcm3ap UTSW 10 76507539 missense probably damaging 0.96
R5316:Mcm3ap UTSW 10 76470926 missense possibly damaging 0.89
R5402:Mcm3ap UTSW 10 76483314 missense probably benign 0.04
R5459:Mcm3ap UTSW 10 76496482 nonsense probably null
R5473:Mcm3ap UTSW 10 76502759 missense probably damaging 1.00
R5570:Mcm3ap UTSW 10 76481096 missense possibly damaging 0.89
R5931:Mcm3ap UTSW 10 76471166 missense probably benign
R5939:Mcm3ap UTSW 10 76508361 missense probably benign 0.00
R5950:Mcm3ap UTSW 10 76488419 missense possibly damaging 0.46
R5998:Mcm3ap UTSW 10 76481142 critical splice donor site probably null
R6122:Mcm3ap UTSW 10 76506607 missense probably damaging 1.00
R6192:Mcm3ap UTSW 10 76501100 missense probably damaging 0.97
R6226:Mcm3ap UTSW 10 76515706 missense possibly damaging 0.95
R6293:Mcm3ap UTSW 10 76471478 nonsense probably null
R6669:Mcm3ap UTSW 10 76507337 missense probably damaging 0.98
R6715:Mcm3ap UTSW 10 76489532 missense possibly damaging 0.68
R6759:Mcm3ap UTSW 10 76501314 missense probably benign
R6864:Mcm3ap UTSW 10 76507479 missense probably damaging 1.00
R6870:Mcm3ap UTSW 10 76470215 missense probably benign 0.00
R6935:Mcm3ap UTSW 10 76504253 missense possibly damaging 0.84
R6947:Mcm3ap UTSW 10 76515666 missense probably benign 0.09
X0026:Mcm3ap UTSW 10 76482785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGATGTGAGGAAGCCATCTCCC -3'
(R):5'- GCACAGACTTTCCCCTGAGAGAATC -3'

Sequencing Primer
(F):5'- CCACCCTCATGAAGGGATTAAAGAG -3'
(R):5'- GTCTGTCAGGGACAACACTTC -3'
Posted On2014-05-23