Incidental Mutation 'R1773:Dhx8'
ID196835
Institutional Source Beutler Lab
Gene Symbol Dhx8
Ensembl Gene ENSMUSG00000034931
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 8
SynonymsRNA helicase, Ddx8, mDEAH6
MMRRC Submission 039804-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock #R1773 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101732919-101767358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101752363 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 754 (Y754H)
Ref Sequence ENSEMBL: ENSMUSP00000037251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039152] [ENSMUST00000129741]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039152
AA Change: Y754H

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037251
Gene: ENSMUSG00000034931
AA Change: Y754H

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 168 240 N/A INTRINSIC
low complexity region 244 254 N/A INTRINSIC
S1 287 360 3.52e-18 SMART
low complexity region 453 469 N/A INTRINSIC
coiled coil region 496 525 N/A INTRINSIC
DEXDc 587 771 7.26e-33 SMART
HELICc 815 919 7.45e-21 SMART
HA2 980 1070 1.34e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129741
AA Change: Y701H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000119430
Gene: ENSMUSG00000034931
AA Change: Y701H

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 115 187 N/A INTRINSIC
low complexity region 191 201 N/A INTRINSIC
S1 234 307 3.52e-18 SMART
low complexity region 400 416 N/A INTRINSIC
coiled coil region 443 472 N/A INTRINSIC
DEXDc 534 718 7.26e-33 SMART
HELICc 762 866 7.45e-21 SMART
HA2 927 1017 1.34e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141461
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH box polypeptide family. The encoded protein contains the DEAH (Asp-Glu-Ala-His) motif which is characteristic of all DEAH box proteins, and is thought to function as an ATP-dependent RNA helicase that regulates the release of spliced mRNAs from spliceosomes prior to their export from the nucleus. This protein may be required for the replication of human immunodeficiency virus type 1 (HIV-1). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,580,595 K334E probably damaging Het
Abca12 A G 1: 71,288,596 Y1442H probably damaging Het
Acot12 A G 13: 91,757,557 T79A probably benign Het
Adipoq A C 16: 23,155,238 Q26P unknown Het
Akap13 T A 7: 75,683,451 N1582K possibly damaging Het
Alg9 A G 9: 50,779,096 T133A probably benign Het
Anks3 T C 16: 4,947,294 T418A probably benign Het
Ano3 A C 2: 110,761,455 L37R probably damaging Het
Ano9 A G 7: 141,108,378 F178L possibly damaging Het
Arhgef12 A G 9: 43,005,542 probably null Het
Arl16 T A 11: 120,465,763 I137F possibly damaging Het
Brpf1 T A 6: 113,319,931 S959T possibly damaging Het
C530008M17Rik G T 5: 76,867,205 A42S possibly damaging Het
Ccdc27 C T 4: 154,041,765 R89Q unknown Het
Cd109 A C 9: 78,703,724 Q1207H probably benign Het
Cd14 A T 18: 36,725,304 V366D possibly damaging Het
Cep290 G A 10: 100,510,573 V538I probably benign Het
Cep57 G A 9: 13,816,068 A202V probably damaging Het
Chl1 T C 6: 103,647,331 probably null Het
Cmah T G 13: 24,417,299 F29L probably benign Het
Crybg1 A G 10: 43,992,548 V1378A possibly damaging Het
Cryzl2 A G 1: 157,470,722 K227R probably benign Het
D130043K22Rik T G 13: 24,882,602 V794G possibly damaging Het
Ddx4 T A 13: 112,599,902 T645S probably benign Het
Dhcr7 C T 7: 143,847,458 R453C possibly damaging Het
Dip2b T A 15: 100,193,961 D860E probably benign Het
Dnah7a T C 1: 53,432,887 probably null Het
Dst A G 1: 34,291,899 D6937G probably damaging Het
Dusp1 A G 17: 26,507,107 I204T probably damaging Het
Dync2h1 T A 9: 7,128,256 Q1859L probably damaging Het
E4f1 C A 17: 24,446,584 G328V probably damaging Het
Eml5 T C 12: 98,798,839 Y1617C probably damaging Het
Espn G T 4: 152,128,229 P622Q probably damaging Het
Fam184b G A 5: 45,584,334 P185L possibly damaging Het
Fam71f1 T C 6: 29,334,153 S335P possibly damaging Het
Fn1 T A 1: 71,637,383 D563V probably damaging Het
Gad2 A G 2: 22,690,207 Y540C probably benign Het
Gdf11 T C 10: 128,891,294 D131G probably damaging Het
Gm19965 T A 1: 116,821,259 Y223* probably null Het
H2-M10.6 A G 17: 36,812,184 K3R probably benign Het
Hid1 A G 11: 115,348,510 Y776H probably damaging Het
Hivep3 A T 4: 120,098,837 K1450I probably damaging Het
Icam5 T C 9: 21,033,525 L128P possibly damaging Het
Idnk T C 13: 58,157,712 V9A probably damaging Het
Il4ra A T 7: 125,567,182 T33S possibly damaging Het
Ino80 A G 2: 119,418,409 V990A probably benign Het
Krtap4-9 T C 11: 99,785,570 probably benign Het
Lrrk2 A G 15: 91,779,981 I1974V possibly damaging Het
Mcm3ap C T 10: 76,471,160 A369V probably benign Het
Nek6 A G 2: 38,582,419 M252V probably benign Het
Nfasc T A 1: 132,610,839 I443F probably damaging Het
Nme8 T G 13: 19,697,036 M1L probably damaging Het
Npnt T A 3: 132,904,693 Q423L possibly damaging Het
Nup133 A T 8: 123,930,983 C404* probably null Het
Olfr1232 A G 2: 89,325,742 V146A probably benign Het
Olfr1307 A G 2: 111,944,859 V199A possibly damaging Het
Olfr1535 T C 13: 21,555,812 D70G probably damaging Het
Olfr262 T C 19: 12,241,659 M1V probably null Het
Olfr684 T C 7: 105,156,983 E233G probably benign Het
Olfr806 A G 10: 129,738,443 L158S probably damaging Het
Otog T A 7: 46,288,159 I1764N probably benign Het
Oxa1l A G 14: 54,363,452 I127M probably benign Het
P4hb C A 11: 120,572,726 V28F probably damaging Het
Pbld2 C T 10: 63,054,371 A186V probably benign Het
Pdzph1 G T 17: 58,974,813 T158K probably damaging Het
Pgm1 T A 5: 64,107,851 probably null Het
Phip A T 9: 82,876,189 S1484T probably benign Het
Pikfyve T C 1: 65,192,271 L100P probably damaging Het
Pikfyve T C 1: 65,246,370 S923P probably benign Het
Pla2g4e A G 2: 120,244,721 S63P probably benign Het
Plekhh2 A G 17: 84,599,265 E1176G probably damaging Het
Prlr T A 15: 10,325,318 Y192* probably null Het
Pten T A 19: 32,798,072 C71S probably damaging Het
Rbbp8nl A G 2: 180,281,194 L202P probably benign Het
Ripor2 T A 13: 24,701,254 S491T probably benign Het
Robo1 A T 16: 73,004,511 I1008F probably benign Het
Scg2 T C 1: 79,435,635 N417S probably benign Het
Scn8a A G 15: 101,039,615 I1581V probably damaging Het
Slc22a8 T A 19: 8,594,229 I108N probably damaging Het
Slc9a8 A T 2: 167,471,465 T416S possibly damaging Het
Spata32 T A 11: 103,208,818 E287V probably damaging Het
Spata5 T C 3: 37,439,185 F515L probably damaging Het
Tgfbrap1 C T 1: 43,075,352 G196D probably damaging Het
Tgm5 G T 2: 121,077,650 T15K possibly damaging Het
Tmc1 C T 19: 20,826,501 probably null Het
Tmem177 T C 1: 119,910,576 I124M possibly damaging Het
Trim30a A G 7: 104,435,901 F34S probably damaging Het
Tsn T C 1: 118,305,239 T112A probably benign Het
Tspyl5 T G 15: 33,686,776 N341T probably benign Het
Vmn2r108 C T 17: 20,469,073 C540Y probably damaging Het
Vrtn C T 12: 84,650,224 R583W probably damaging Het
Wnt1 T C 15: 98,791,757 S142P probably damaging Het
Wrn A T 8: 33,343,561 I108N probably damaging Het
Zfhx2 A C 14: 55,072,891 C733G possibly damaging Het
Zfp219 T C 14: 52,007,106 T539A probably damaging Het
Zswim8 T A 14: 20,711,530 M177K probably damaging Het
Other mutations in Dhx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01922:Dhx8 APN 11 101739807 missense probably damaging 0.99
IGL01957:Dhx8 APN 11 101754826 missense possibly damaging 0.48
IGL02039:Dhx8 APN 11 101764027 critical splice donor site probably null
IGL02115:Dhx8 APN 11 101752388 missense probably damaging 1.00
IGL02161:Dhx8 APN 11 101757606 missense probably damaging 1.00
IGL02691:Dhx8 APN 11 101752004 splice site probably benign
IGL02697:Dhx8 APN 11 101754781 missense probably damaging 1.00
FR4304:Dhx8 UTSW 11 101738188 small insertion probably benign
FR4342:Dhx8 UTSW 11 101738206 frame shift probably null
FR4449:Dhx8 UTSW 11 101738184 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738190 small deletion probably benign
FR4449:Dhx8 UTSW 11 101738194 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738206 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738207 small insertion probably benign
FR4589:Dhx8 UTSW 11 101738188 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738179 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738182 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738189 small insertion probably benign
R0402:Dhx8 UTSW 11 101752397 missense probably damaging 1.00
R0525:Dhx8 UTSW 11 101763928 missense probably damaging 1.00
R0969:Dhx8 UTSW 11 101739700 splice site probably benign
R1497:Dhx8 UTSW 11 101735387 intron probably benign
R1576:Dhx8 UTSW 11 101752319 missense probably damaging 1.00
R1758:Dhx8 UTSW 11 101766738 missense probably damaging 1.00
R1941:Dhx8 UTSW 11 101752198 critical splice donor site probably null
R1954:Dhx8 UTSW 11 101753279 missense probably damaging 0.98
R2124:Dhx8 UTSW 11 101762245 missense probably damaging 0.99
R2128:Dhx8 UTSW 11 101738409 missense probably benign 0.06
R2148:Dhx8 UTSW 11 101738377 nonsense probably null
R2206:Dhx8 UTSW 11 101750971 missense probably benign 0.03
R2207:Dhx8 UTSW 11 101750971 missense probably benign 0.03
R4667:Dhx8 UTSW 11 101738161 missense unknown
R4678:Dhx8 UTSW 11 101739808 missense probably damaging 1.00
R4825:Dhx8 UTSW 11 101738170 nonsense probably null
R4943:Dhx8 UTSW 11 101737700 nonsense probably null
R5341:Dhx8 UTSW 11 101738190 small deletion probably benign
R5586:Dhx8 UTSW 11 101733036 unclassified probably benign
R5662:Dhx8 UTSW 11 101766758 missense possibly damaging 0.89
R5664:Dhx8 UTSW 11 101740751 missense probably damaging 1.00
R6082:Dhx8 UTSW 11 101764313 missense probably damaging 1.00
R6085:Dhx8 UTSW 11 101764313 missense probably damaging 1.00
R6415:Dhx8 UTSW 11 101737687 missense unknown
R6658:Dhx8 UTSW 11 101764922 missense probably damaging 1.00
R6841:Dhx8 UTSW 11 101764792 missense probably damaging 0.98
R6918:Dhx8 UTSW 11 101738421 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACGAGAGGACCATTCACACAGATG -3'
(R):5'- TGCCTGAGGCTTACAAAGAGCAAAC -3'

Sequencing Primer
(F):5'- CACACAGATGTGCTCTTTGG -3'
(R):5'- TGTGTTTCACAAGACTAGCAGAAG -3'
Posted On2014-05-23