Incidental Mutation 'R1773:Arl16'
ID196838
Institutional Source Beutler Lab
Gene Symbol Arl16
Ensembl Gene ENSMUSG00000057594
Gene NameADP-ribosylation factor-like 16
Synonyms
MMRRC Submission 039804-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R1773 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120464866-120467607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120465763 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 137 (I137F)
Ref Sequence ENSEMBL: ENSMUSP00000076188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026900] [ENSMUST00000058370] [ENSMUST00000076921] [ENSMUST00000106203] [ENSMUST00000106205] [ENSMUST00000140862]
Predicted Effect probably benign
Transcript: ENSMUST00000026900
SMART Domains Protein: ENSMUSP00000026900
Gene: ENSMUSG00000116045

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 406 500 1.2e-41 PFAM
low complexity region 637 658 N/A INTRINSIC
low complexity region 746 767 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058370
SMART Domains Protein: ENSMUSP00000062540
Gene: ENSMUSG00000049957

DomainStartEndE-ValueType
low complexity region 18 39 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
coiled coil region 160 189 N/A INTRINSIC
low complexity region 219 245 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000076921
AA Change: I137F

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076188
Gene: ENSMUSG00000057594
AA Change: I137F

DomainStartEndE-ValueType
Pfam:Arf 1 169 1.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106203
SMART Domains Protein: ENSMUSP00000101809
Gene: ENSMUSG00000025793

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 405 500 2.2e-48 PFAM
low complexity region 724 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106205
SMART Domains Protein: ENSMUSP00000101811
Gene: ENSMUSG00000025793

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 404 499 2.2e-48 PFAM
low complexity region 723 738 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137639
Predicted Effect probably benign
Transcript: ENSMUST00000140862
SMART Domains Protein: ENSMUSP00000119396
Gene: ENSMUSG00000025793

DomainStartEndE-ValueType
VHS 8 123 1.29e-48 SMART
FYVE 139 205 1.81e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154136
Predicted Effect probably benign
Transcript: ENSMUST00000176120
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ARL (ADP-ribosylation factor-like) family of proteins, which are structurally related to ADP-ribosylation factors (ARFs). This protein has been shown to have an inhibitory role in the cellular antiviral response. This gene product interacts with the C-terminal domain of the DEXD/H-box helicase 58 (DDX58) gene product. This interaction was found to suppress the association between the DDX58 gene product and RNA, thereby negatively regulating the activity of the DDX58 gene product. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,580,595 K334E probably damaging Het
Abca12 A G 1: 71,288,596 Y1442H probably damaging Het
Acot12 A G 13: 91,757,557 T79A probably benign Het
Adipoq A C 16: 23,155,238 Q26P unknown Het
Akap13 T A 7: 75,683,451 N1582K possibly damaging Het
Alg9 A G 9: 50,779,096 T133A probably benign Het
Anks3 T C 16: 4,947,294 T418A probably benign Het
Ano3 A C 2: 110,761,455 L37R probably damaging Het
Ano9 A G 7: 141,108,378 F178L possibly damaging Het
Arhgef12 A G 9: 43,005,542 probably null Het
Brpf1 T A 6: 113,319,931 S959T possibly damaging Het
C530008M17Rik G T 5: 76,867,205 A42S possibly damaging Het
Ccdc27 C T 4: 154,041,765 R89Q unknown Het
Cd109 A C 9: 78,703,724 Q1207H probably benign Het
Cd14 A T 18: 36,725,304 V366D possibly damaging Het
Cep290 G A 10: 100,510,573 V538I probably benign Het
Cep57 G A 9: 13,816,068 A202V probably damaging Het
Chl1 T C 6: 103,647,331 probably null Het
Cmah T G 13: 24,417,299 F29L probably benign Het
Crybg1 A G 10: 43,992,548 V1378A possibly damaging Het
Cryzl2 A G 1: 157,470,722 K227R probably benign Het
D130043K22Rik T G 13: 24,882,602 V794G possibly damaging Het
Ddx4 T A 13: 112,599,902 T645S probably benign Het
Dhcr7 C T 7: 143,847,458 R453C possibly damaging Het
Dhx8 T C 11: 101,752,363 Y754H possibly damaging Het
Dip2b T A 15: 100,193,961 D860E probably benign Het
Dnah7a T C 1: 53,432,887 probably null Het
Dst A G 1: 34,291,899 D6937G probably damaging Het
Dusp1 A G 17: 26,507,107 I204T probably damaging Het
Dync2h1 T A 9: 7,128,256 Q1859L probably damaging Het
E4f1 C A 17: 24,446,584 G328V probably damaging Het
Eml5 T C 12: 98,798,839 Y1617C probably damaging Het
Espn G T 4: 152,128,229 P622Q probably damaging Het
Fam184b G A 5: 45,584,334 P185L possibly damaging Het
Fam71f1 T C 6: 29,334,153 S335P possibly damaging Het
Fn1 T A 1: 71,637,383 D563V probably damaging Het
Gad2 A G 2: 22,690,207 Y540C probably benign Het
Gdf11 T C 10: 128,891,294 D131G probably damaging Het
Gm19965 T A 1: 116,821,259 Y223* probably null Het
H2-M10.6 A G 17: 36,812,184 K3R probably benign Het
Hid1 A G 11: 115,348,510 Y776H probably damaging Het
Hivep3 A T 4: 120,098,837 K1450I probably damaging Het
Icam5 T C 9: 21,033,525 L128P possibly damaging Het
Idnk T C 13: 58,157,712 V9A probably damaging Het
Il4ra A T 7: 125,567,182 T33S possibly damaging Het
Ino80 A G 2: 119,418,409 V990A probably benign Het
Krtap4-9 T C 11: 99,785,570 probably benign Het
Lrrk2 A G 15: 91,779,981 I1974V possibly damaging Het
Mcm3ap C T 10: 76,471,160 A369V probably benign Het
Nek6 A G 2: 38,582,419 M252V probably benign Het
Nfasc T A 1: 132,610,839 I443F probably damaging Het
Nme8 T G 13: 19,697,036 M1L probably damaging Het
Npnt T A 3: 132,904,693 Q423L possibly damaging Het
Nup133 A T 8: 123,930,983 C404* probably null Het
Olfr1232 A G 2: 89,325,742 V146A probably benign Het
Olfr1307 A G 2: 111,944,859 V199A possibly damaging Het
Olfr1535 T C 13: 21,555,812 D70G probably damaging Het
Olfr262 T C 19: 12,241,659 M1V probably null Het
Olfr684 T C 7: 105,156,983 E233G probably benign Het
Olfr806 A G 10: 129,738,443 L158S probably damaging Het
Otog T A 7: 46,288,159 I1764N probably benign Het
Oxa1l A G 14: 54,363,452 I127M probably benign Het
P4hb C A 11: 120,572,726 V28F probably damaging Het
Pbld2 C T 10: 63,054,371 A186V probably benign Het
Pdzph1 G T 17: 58,974,813 T158K probably damaging Het
Pgm1 T A 5: 64,107,851 probably null Het
Phip A T 9: 82,876,189 S1484T probably benign Het
Pikfyve T C 1: 65,192,271 L100P probably damaging Het
Pikfyve T C 1: 65,246,370 S923P probably benign Het
Pla2g4e A G 2: 120,244,721 S63P probably benign Het
Plekhh2 A G 17: 84,599,265 E1176G probably damaging Het
Prlr T A 15: 10,325,318 Y192* probably null Het
Pten T A 19: 32,798,072 C71S probably damaging Het
Rbbp8nl A G 2: 180,281,194 L202P probably benign Het
Ripor2 T A 13: 24,701,254 S491T probably benign Het
Robo1 A T 16: 73,004,511 I1008F probably benign Het
Scg2 T C 1: 79,435,635 N417S probably benign Het
Scn8a A G 15: 101,039,615 I1581V probably damaging Het
Slc22a8 T A 19: 8,594,229 I108N probably damaging Het
Slc9a8 A T 2: 167,471,465 T416S possibly damaging Het
Spata32 T A 11: 103,208,818 E287V probably damaging Het
Spata5 T C 3: 37,439,185 F515L probably damaging Het
Tgfbrap1 C T 1: 43,075,352 G196D probably damaging Het
Tgm5 G T 2: 121,077,650 T15K possibly damaging Het
Tmc1 C T 19: 20,826,501 probably null Het
Tmem177 T C 1: 119,910,576 I124M possibly damaging Het
Trim30a A G 7: 104,435,901 F34S probably damaging Het
Tsn T C 1: 118,305,239 T112A probably benign Het
Tspyl5 T G 15: 33,686,776 N341T probably benign Het
Vmn2r108 C T 17: 20,469,073 C540Y probably damaging Het
Vrtn C T 12: 84,650,224 R583W probably damaging Het
Wnt1 T C 15: 98,791,757 S142P probably damaging Het
Wrn A T 8: 33,343,561 I108N probably damaging Het
Zfhx2 A C 14: 55,072,891 C733G possibly damaging Het
Zfp219 T C 14: 52,007,106 T539A probably damaging Het
Zswim8 T A 14: 20,711,530 M177K probably damaging Het
Other mutations in Arl16
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1027:Arl16 UTSW 11 120465696 missense probably benign 0.03
R1820:Arl16 UTSW 11 120466761 missense probably damaging 0.99
R4632:Arl16 UTSW 11 120465784 missense probably damaging 1.00
R5915:Arl16 UTSW 11 120466605 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTTACTGGTCACAGCACAGCCC -3'
(R):5'- TGATGGATGCTTCTAACCCCACCC -3'

Sequencing Primer
(F):5'- TCACTTGCAGATACACTGGG -3'
(R):5'- GTATCCCAAGGGGTTGCTCTAC -3'
Posted On2014-05-23