Incidental Mutation 'R1776:Ankle1'
ID197026
Institutional Source Beutler Lab
Gene Symbol Ankle1
Ensembl Gene ENSMUSG00000046295
Gene Nameankyrin repeat and LEM domain containing 1
Synonyms8430438L13Rik, Ankrd41
MMRRC Submission 039807-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R1776 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71406010-71409904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 71409274 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 474 (V474F)
Ref Sequence ENSEMBL: ENSMUSP00000112797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002473] [ENSMUST00000119976] [ENSMUST00000120725]
Predicted Effect probably benign
Transcript: ENSMUST00000002473
SMART Domains Protein: ENSMUSP00000002473
Gene: ENSMUSG00000031820

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 321 331 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119976
AA Change: V494F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113162
Gene: ENSMUSG00000046295
AA Change: V494F

DomainStartEndE-ValueType
ANK 6 35 7.52e2 SMART
ANK 39 71 4.01e0 SMART
ANK 75 104 2.37e-2 SMART
ANK 108 139 1.99e2 SMART
low complexity region 177 193 N/A INTRINSIC
Pfam:LEM 282 319 4.6e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120725
AA Change: V474F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112797
Gene: ENSMUSG00000046295
AA Change: V474F

DomainStartEndE-ValueType
ANK 6 35 7.52e2 SMART
ANK 39 71 4.01e0 SMART
ANK 75 104 2.37e-2 SMART
ANK 108 139 1.99e2 SMART
low complexity region 157 173 N/A INTRINSIC
Pfam:LEM 261 300 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136522
Meta Mutation Damage Score 0.0384 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency 98% (86/88)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes no overt phenotype or detectable defects in hematopoiesis. Mouse embryonic fibroblasts do not show an impaired DNA damage response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T C 10: 70,875,228 noncoding transcript Het
9430097D07Rik T C 2: 32,574,755 probably benign Het
A2m C G 6: 121,641,424 F225L probably damaging Het
Adamts19 T A 18: 58,954,620 I574N probably damaging Het
AI314180 A G 4: 58,879,100 I63T probably damaging Het
Ankfn1 T C 11: 89,526,474 D104G possibly damaging Het
Ankhd1 T A 18: 36,647,308 N1804K probably benign Het
Arfgap3 A G 15: 83,343,139 V24A probably benign Het
Asph A T 4: 9,598,773 S149R probably damaging Het
Cass4 A T 2: 172,427,695 I568L probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdx1 G A 18: 61,036,014 A36V probably benign Het
Cep57 A T 9: 13,818,874 S123T probably damaging Het
Clca3a2 T A 3: 144,813,920 Q231L probably damaging Het
Clcnkb T C 4: 141,415,189 probably benign Het
Crabp2 C A 3: 87,952,994 T125K probably benign Het
Dennd3 A G 15: 73,555,101 T776A possibly damaging Het
Dnajb6 T C 5: 29,785,093 probably benign Het
Dsp T A 13: 38,196,617 I1847N probably damaging Het
Dync1h1 T C 12: 110,632,928 probably benign Het
Fbn1 A C 2: 125,321,734 F2067L possibly damaging Het
Fbxo16 T A 14: 65,295,386 probably null Het
Gm3604 C A 13: 62,370,074 G157* probably null Het
Gm5250 A G 1: 13,062,340 noncoding transcript Het
Gpam A G 19: 55,078,575 S503P possibly damaging Het
Herc4 T A 10: 63,264,171 C124* probably null Het
Ift27 T C 15: 78,165,981 D76G probably null Het
Igdcc3 C T 9: 65,182,752 Q550* probably null Het
Igsf6 T A 7: 121,068,299 I165F probably damaging Het
Il31ra T C 13: 112,541,239 I173M probably damaging Het
Kbtbd6 G A 14: 79,452,605 D247N probably benign Het
Kcnq2 T A 2: 181,100,557 T394S probably benign Het
Mia2 A G 12: 59,149,575 probably benign Het
Mvp T C 7: 126,992,761 Q419R probably benign Het
Mylk A G 16: 34,952,782 D1250G probably benign Het
Necab1 A G 4: 15,111,267 Y54H probably damaging Het
Nlk T A 11: 78,587,027 M297L probably benign Het
Nsl1 G T 1: 191,063,188 M50I probably benign Het
Numa1 A G 7: 102,011,050 T441A probably damaging Het
Ofd1 A G X: 166,406,006 Y755H probably benign Het
Olfr810 C T 10: 129,791,131 V153I probably benign Het
Olfr870 G A 9: 20,170,809 T254I probably benign Het
Olfr934 G A 9: 38,982,894 S50F probably damaging Het
Ovgp1 A T 3: 105,977,798 H151L possibly damaging Het
Pigz G A 16: 31,944,579 E152K probably damaging Het
Plxna1 A T 6: 89,335,464 D779E probably benign Het
Ppil4 A T 10: 7,810,437 E353V probably benign Het
Ptprq C T 10: 107,685,089 G741S probably damaging Het
Rplp0 T C 5: 115,562,465 Y231H probably benign Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rundc3b T C 5: 8,579,050 E117G probably damaging Het
Ryr2 A C 13: 11,745,176 probably null Het
Ryr3 A T 2: 112,957,253 M198K probably damaging Het
Sdhd T C 9: 50,597,200 K122R probably benign Het
Senp2 T C 16: 22,043,060 probably benign Het
Setd3 C A 12: 108,165,161 G2V probably damaging Het
Sfxn5 A G 6: 85,267,945 probably benign Het
She T A 3: 89,832,038 S179T possibly damaging Het
Slc24a2 G A 4: 87,176,289 T331I probably benign Het
Slc45a3 T C 1: 131,976,956 W6R possibly damaging Het
Slc9a4 T C 1: 40,629,287 S697P probably benign Het
Soat1 C T 1: 156,442,421 V143I probably benign Het
Sp8 T A 12: 118,849,567 F386I probably damaging Het
Spata31d1b A G 13: 59,716,567 T510A probably benign Het
Srgap2 T A 1: 131,411,850 I125F probably damaging Het
Stab2 T A 10: 86,957,816 I472F possibly damaging Het
Taar7f C T 10: 24,049,648 R47C probably benign Het
Tbc1d19 T A 5: 53,889,311 probably null Het
Tbc1d21 T A 9: 58,366,728 probably benign Het
Tcaf1 A G 6: 42,678,455 I529T possibly damaging Het
Tgfbr2 A T 9: 116,174,967 I24N possibly damaging Het
Tgm1 T C 14: 55,709,397 T385A probably damaging Het
Tgm2 T C 2: 158,131,459 N244S probably benign Het
Thoc5 T C 11: 4,914,517 probably benign Het
Tmc2 A T 2: 130,234,869 I372F probably damaging Het
Tnrc6a A G 7: 123,171,297 D222G probably damaging Het
Trhde T G 10: 114,800,603 N233T probably benign Het
Tstd3 T C 4: 21,759,475 Y99C probably damaging Het
Ttc22 A T 4: 106,639,040 D429V possibly damaging Het
Ugcg A G 4: 59,207,775 N38S probably benign Het
Ush2a A G 1: 188,728,203 I2554V possibly damaging Het
Usp16 A G 16: 87,479,316 D513G probably damaging Het
Vip T C 10: 5,644,992 probably null Het
Vmn1r4 A G 6: 56,957,038 I176V probably benign Het
Zfp804b T C 5: 6,769,806 T1050A probably damaging Het
Other mutations in Ankle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Ankle1 APN 8 71406259 missense probably damaging 1.00
IGL02558:Ankle1 APN 8 71408992 missense probably damaging 1.00
IGL02938:Ankle1 APN 8 71406252 missense probably damaging 1.00
R0358:Ankle1 UTSW 8 71407545 missense probably damaging 1.00
R1313:Ankle1 UTSW 8 71407213 missense possibly damaging 0.61
R1313:Ankle1 UTSW 8 71407213 missense possibly damaging 0.61
R1681:Ankle1 UTSW 8 71407618 missense probably benign 0.00
R2070:Ankle1 UTSW 8 71409344 missense probably damaging 1.00
R2073:Ankle1 UTSW 8 71409329 missense possibly damaging 0.94
R2116:Ankle1 UTSW 8 71407918 missense probably benign 0.13
R2117:Ankle1 UTSW 8 71407918 missense probably benign 0.13
R4610:Ankle1 UTSW 8 71407207 intron probably benign
R5027:Ankle1 UTSW 8 71408979 missense probably damaging 1.00
R7051:Ankle1 UTSW 8 71407743 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGGTCACATGAAAGGTATCCGAGC -3'
(R):5'- TCCTCTGAAGCTAGAGCTGGGAAC -3'

Sequencing Primer
(F):5'- GGTATCCGAGCTATGAATCCC -3'
(R):5'- TTAGGAACCAGCCAGATGCTC -3'
Posted On2014-05-23