Incidental Mutation 'R1776:Cep57'
ID197027
Institutional Source Beutler Lab
Gene Symbol Cep57
Ensembl Gene ENSMUSG00000031922
Gene Namecentrosomal protein 57
Synonyms4931428M20Rik, Tsp57, 3110002L15Rik, 4921510P06Rik
MMRRC Submission 039807-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R1776 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location13807792-13827107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13818874 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 123 (S123T)
Ref Sequence ENSEMBL: ENSMUSP00000034398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034398] [ENSMUST00000124883] [ENSMUST00000134746] [ENSMUST00000142494] [ENSMUST00000144484] [ENSMUST00000147115] [ENSMUST00000148086] [ENSMUST00000150893]
Predicted Effect probably damaging
Transcript: ENSMUST00000034398
AA Change: S123T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034398
Gene: ENSMUSG00000031922
AA Change: S123T

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 245 9.8e-67 PFAM
low complexity region 259 271 N/A INTRINSIC
Pfam:Cep57_MT_bd 348 420 2.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124524
Predicted Effect probably benign
Transcript: ENSMUST00000124883
SMART Domains Protein: ENSMUSP00000119081
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
Pfam:Cep57_CLD 1 96 4.7e-34 PFAM
low complexity region 110 122 N/A INTRINSIC
Pfam:Cep57_MT_bd 196 271 4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134746
AA Change: S123T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116713
Gene: ENSMUSG00000031922
AA Change: S123T

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 209 1e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000142494
AA Change: S123T

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114749
Gene: ENSMUSG00000031922
AA Change: S123T

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 245 3.3e-72 PFAM
low complexity region 259 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144484
SMART Domains Protein: ENSMUSP00000114940
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000147115
AA Change: S123T

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116931
Gene: ENSMUSG00000031922
AA Change: S123T

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 245 2.1e-72 PFAM
low complexity region 254 275 N/A INTRINSIC
Pfam:Cep57_MT_bd 319 394 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148086
AA Change: S96T

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000114665
Gene: ENSMUSG00000031922
AA Change: S96T

DomainStartEndE-ValueType
Pfam:Cep57_CLD 41 218 1e-71 PFAM
low complexity region 232 244 N/A INTRINSIC
Pfam:Cep57_MT_bd 318 393 6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148904
Predicted Effect probably benign
Transcript: ENSMUST00000150893
SMART Domains Protein: ENSMUSP00000115338
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
Pfam:Cep57_CLD 1 96 5.2e-37 PFAM
low complexity region 110 122 N/A INTRINSIC
Pfam:Cep57_MT_bd 196 271 2.6e-24 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000151878
AA Change: S12T
SMART Domains Protein: ENSMUSP00000116847
Gene: ENSMUSG00000031922
AA Change: S12T

DomainStartEndE-ValueType
Pfam:Cep57_CLD 1 133 1.6e-43 PFAM
low complexity region 147 159 N/A INTRINSIC
Meta Mutation Damage Score 0.22 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein called Translokin. This protein localizes to the centrosome and has a function in microtubular stabilization. The N-terminal half of this protein is required for its centrosome localization and for its multimerization, and the C-terminal half is required for nucleating, bundling and anchoring microtubules to the centrosomes. This protein specifically interacts with fibroblast growth factor 2 (FGF2), sorting nexin 6, Ran-binding protein M and the kinesins KIF3A and KIF3B, and thus mediates the nuclear translocation and mitogenic activity of the FGF2. It also interacts with cyclin D1 and controls nucleocytoplasmic distribution of the cyclin D1 in quiescent cells. This protein is crucial for maintaining correct chromosomal number during cell division. Mutations in this gene cause mosaic variegated aneuploidy syndrome, a rare autosomal recessive disorder. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T C 10: 70,875,228 noncoding transcript Het
9430097D07Rik T C 2: 32,574,755 probably benign Het
A2m C G 6: 121,641,424 F225L probably damaging Het
Adamts19 T A 18: 58,954,620 I574N probably damaging Het
AI314180 A G 4: 58,879,100 I63T probably damaging Het
Ankfn1 T C 11: 89,526,474 D104G possibly damaging Het
Ankhd1 T A 18: 36,647,308 N1804K probably benign Het
Ankle1 G T 8: 71,409,274 V474F probably damaging Het
Arfgap3 A G 15: 83,343,139 V24A probably benign Het
Asph A T 4: 9,598,773 S149R probably damaging Het
Cass4 A T 2: 172,427,695 I568L probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdx1 G A 18: 61,036,014 A36V probably benign Het
Clca3a2 T A 3: 144,813,920 Q231L probably damaging Het
Clcnkb T C 4: 141,415,189 probably benign Het
Crabp2 C A 3: 87,952,994 T125K probably benign Het
Dennd3 A G 15: 73,555,101 T776A possibly damaging Het
Dnajb6 T C 5: 29,785,093 probably benign Het
Dsp T A 13: 38,196,617 I1847N probably damaging Het
Dync1h1 T C 12: 110,632,928 probably benign Het
Fbn1 A C 2: 125,321,734 F2067L possibly damaging Het
Fbxo16 T A 14: 65,295,386 probably null Het
Gm3604 C A 13: 62,370,074 G157* probably null Het
Gm5250 A G 1: 13,062,340 noncoding transcript Het
Gpam A G 19: 55,078,575 S503P possibly damaging Het
Herc4 T A 10: 63,264,171 C124* probably null Het
Ift27 T C 15: 78,165,981 D76G probably null Het
Igdcc3 C T 9: 65,182,752 Q550* probably null Het
Igsf6 T A 7: 121,068,299 I165F probably damaging Het
Il31ra T C 13: 112,541,239 I173M probably damaging Het
Kbtbd6 G A 14: 79,452,605 D247N probably benign Het
Kcnq2 T A 2: 181,100,557 T394S probably benign Het
Mia2 A G 12: 59,149,575 probably benign Het
Mvp T C 7: 126,992,761 Q419R probably benign Het
Mylk A G 16: 34,952,782 D1250G probably benign Het
Necab1 A G 4: 15,111,267 Y54H probably damaging Het
Nlk T A 11: 78,587,027 M297L probably benign Het
Nsl1 G T 1: 191,063,188 M50I probably benign Het
Numa1 A G 7: 102,011,050 T441A probably damaging Het
Ofd1 A G X: 166,406,006 Y755H probably benign Het
Olfr810 C T 10: 129,791,131 V153I probably benign Het
Olfr870 G A 9: 20,170,809 T254I probably benign Het
Olfr934 G A 9: 38,982,894 S50F probably damaging Het
Ovgp1 A T 3: 105,977,798 H151L possibly damaging Het
Pigz G A 16: 31,944,579 E152K probably damaging Het
Plxna1 A T 6: 89,335,464 D779E probably benign Het
Ppil4 A T 10: 7,810,437 E353V probably benign Het
Ptprq C T 10: 107,685,089 G741S probably damaging Het
Rplp0 T C 5: 115,562,465 Y231H probably benign Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rundc3b T C 5: 8,579,050 E117G probably damaging Het
Ryr2 A C 13: 11,745,176 probably null Het
Ryr3 A T 2: 112,957,253 M198K probably damaging Het
Sdhd T C 9: 50,597,200 K122R probably benign Het
Senp2 T C 16: 22,043,060 probably benign Het
Setd3 C A 12: 108,165,161 G2V probably damaging Het
Sfxn5 A G 6: 85,267,945 probably benign Het
She T A 3: 89,832,038 S179T possibly damaging Het
Slc24a2 G A 4: 87,176,289 T331I probably benign Het
Slc45a3 T C 1: 131,976,956 W6R possibly damaging Het
Slc9a4 T C 1: 40,629,287 S697P probably benign Het
Soat1 C T 1: 156,442,421 V143I probably benign Het
Sp8 T A 12: 118,849,567 F386I probably damaging Het
Spata31d1b A G 13: 59,716,567 T510A probably benign Het
Srgap2 T A 1: 131,411,850 I125F probably damaging Het
Stab2 T A 10: 86,957,816 I472F possibly damaging Het
Taar7f C T 10: 24,049,648 R47C probably benign Het
Tbc1d19 T A 5: 53,889,311 probably null Het
Tbc1d21 T A 9: 58,366,728 probably benign Het
Tcaf1 A G 6: 42,678,455 I529T possibly damaging Het
Tgfbr2 A T 9: 116,174,967 I24N possibly damaging Het
Tgm1 T C 14: 55,709,397 T385A probably damaging Het
Tgm2 T C 2: 158,131,459 N244S probably benign Het
Thoc5 T C 11: 4,914,517 probably benign Het
Tmc2 A T 2: 130,234,869 I372F probably damaging Het
Tnrc6a A G 7: 123,171,297 D222G probably damaging Het
Trhde T G 10: 114,800,603 N233T probably benign Het
Tstd3 T C 4: 21,759,475 Y99C probably damaging Het
Ttc22 A T 4: 106,639,040 D429V possibly damaging Het
Ugcg A G 4: 59,207,775 N38S probably benign Het
Ush2a A G 1: 188,728,203 I2554V possibly damaging Het
Usp16 A G 16: 87,479,316 D513G probably damaging Het
Vip T C 10: 5,644,992 probably null Het
Vmn1r4 A G 6: 56,957,038 I176V probably benign Het
Zfp804b T C 5: 6,769,806 T1050A probably damaging Het
Other mutations in Cep57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Cep57 APN 9 13819016 missense probably damaging 1.00
IGL01712:Cep57 APN 9 13813417 missense possibly damaging 0.72
IGL01965:Cep57 APN 9 13821520 unclassified probably benign
IGL02250:Cep57 APN 9 13810643 missense probably damaging 1.00
IGL02378:Cep57 APN 9 13821546 nonsense probably null
IGL02943:Cep57 APN 9 13818853 splice site probably benign
IGL03244:Cep57 APN 9 13818387 nonsense probably null
R0082:Cep57 UTSW 9 13810876 unclassified probably benign
R0330:Cep57 UTSW 9 13816985 missense probably damaging 1.00
R0786:Cep57 UTSW 9 13809870 missense probably damaging 0.99
R0962:Cep57 UTSW 9 13808743 missense possibly damaging 0.48
R1037:Cep57 UTSW 9 13818979 missense possibly damaging 0.89
R1472:Cep57 UTSW 9 13821554 missense probably benign 0.03
R1773:Cep57 UTSW 9 13816068 missense probably damaging 1.00
R4162:Cep57 UTSW 9 13812633 splice site probably null
R4895:Cep57 UTSW 9 13816153 intron probably benign
R4942:Cep57 UTSW 9 13813427 missense probably damaging 0.96
R5310:Cep57 UTSW 9 13818868 missense probably damaging 1.00
R5566:Cep57 UTSW 9 13821575 missense probably damaging 0.99
R5996:Cep57 UTSW 9 13809879 missense probably damaging 0.99
R6058:Cep57 UTSW 9 13810761 missense possibly damaging 0.75
R7065:Cep57 UTSW 9 13818381 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCGTCAAATATGCCACACACTG -3'
(R):5'- AGTGCTCTGCTGCTTGGCTTAC -3'

Sequencing Primer
(F):5'- TGCCAGTAAGCACTATGCAC -3'
(R):5'- cctctagcccagcgtttc -3'
Posted On2014-05-23