Incidental Mutation 'R1776:Stab2'
ID197040
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Namestabilin 2
SynonymsSTAB-2, FEEL-2
MMRRC Submission 039807-MU
Accession Numbers

Genbank: NM_138673; MGI: 2178743

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1776 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location86841198-87008025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86957816 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 472 (I472F)
Ref Sequence ENSEMBL: ENSMUSP00000048309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035288
AA Change: I472F

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: I472F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T C 10: 70,875,228 noncoding transcript Het
9430097D07Rik T C 2: 32,574,755 probably benign Het
A2m C G 6: 121,641,424 F225L probably damaging Het
Adamts19 T A 18: 58,954,620 I574N probably damaging Het
AI314180 A G 4: 58,879,100 I63T probably damaging Het
Ankfn1 T C 11: 89,526,474 D104G possibly damaging Het
Ankhd1 T A 18: 36,647,308 N1804K probably benign Het
Ankle1 G T 8: 71,409,274 V474F probably damaging Het
Arfgap3 A G 15: 83,343,139 V24A probably benign Het
Asph A T 4: 9,598,773 S149R probably damaging Het
Cass4 A T 2: 172,427,695 I568L probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdx1 G A 18: 61,036,014 A36V probably benign Het
Cep57 A T 9: 13,818,874 S123T probably damaging Het
Clca3a2 T A 3: 144,813,920 Q231L probably damaging Het
Clcnkb T C 4: 141,415,189 probably benign Het
Crabp2 C A 3: 87,952,994 T125K probably benign Het
Dennd3 A G 15: 73,555,101 T776A possibly damaging Het
Dnajb6 T C 5: 29,785,093 probably benign Het
Dsp T A 13: 38,196,617 I1847N probably damaging Het
Dync1h1 T C 12: 110,632,928 probably benign Het
Fbn1 A C 2: 125,321,734 F2067L possibly damaging Het
Fbxo16 T A 14: 65,295,386 probably null Het
Gm3604 C A 13: 62,370,074 G157* probably null Het
Gm5250 A G 1: 13,062,340 noncoding transcript Het
Gpam A G 19: 55,078,575 S503P possibly damaging Het
Herc4 T A 10: 63,264,171 C124* probably null Het
Ift27 T C 15: 78,165,981 D76G probably null Het
Igdcc3 C T 9: 65,182,752 Q550* probably null Het
Igsf6 T A 7: 121,068,299 I165F probably damaging Het
Il31ra T C 13: 112,541,239 I173M probably damaging Het
Kbtbd6 G A 14: 79,452,605 D247N probably benign Het
Kcnq2 T A 2: 181,100,557 T394S probably benign Het
Mia2 A G 12: 59,149,575 probably benign Het
Mvp T C 7: 126,992,761 Q419R probably benign Het
Mylk A G 16: 34,952,782 D1250G probably benign Het
Necab1 A G 4: 15,111,267 Y54H probably damaging Het
Nlk T A 11: 78,587,027 M297L probably benign Het
Nsl1 G T 1: 191,063,188 M50I probably benign Het
Numa1 A G 7: 102,011,050 T441A probably damaging Het
Ofd1 A G X: 166,406,006 Y755H probably benign Het
Olfr810 C T 10: 129,791,131 V153I probably benign Het
Olfr870 G A 9: 20,170,809 T254I probably benign Het
Olfr934 G A 9: 38,982,894 S50F probably damaging Het
Ovgp1 A T 3: 105,977,798 H151L possibly damaging Het
Pigz G A 16: 31,944,579 E152K probably damaging Het
Plxna1 A T 6: 89,335,464 D779E probably benign Het
Ppil4 A T 10: 7,810,437 E353V probably benign Het
Ptprq C T 10: 107,685,089 G741S probably damaging Het
Rplp0 T C 5: 115,562,465 Y231H probably benign Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rundc3b T C 5: 8,579,050 E117G probably damaging Het
Ryr2 A C 13: 11,745,176 probably null Het
Ryr3 A T 2: 112,957,253 M198K probably damaging Het
Sdhd T C 9: 50,597,200 K122R probably benign Het
Senp2 T C 16: 22,043,060 probably benign Het
Setd3 C A 12: 108,165,161 G2V probably damaging Het
Sfxn5 A G 6: 85,267,945 probably benign Het
She T A 3: 89,832,038 S179T possibly damaging Het
Slc24a2 G A 4: 87,176,289 T331I probably benign Het
Slc45a3 T C 1: 131,976,956 W6R possibly damaging Het
Slc9a4 T C 1: 40,629,287 S697P probably benign Het
Soat1 C T 1: 156,442,421 V143I probably benign Het
Sp8 T A 12: 118,849,567 F386I probably damaging Het
Spata31d1b A G 13: 59,716,567 T510A probably benign Het
Srgap2 T A 1: 131,411,850 I125F probably damaging Het
Taar7f C T 10: 24,049,648 R47C probably benign Het
Tbc1d19 T A 5: 53,889,311 probably null Het
Tbc1d21 T A 9: 58,366,728 probably benign Het
Tcaf1 A G 6: 42,678,455 I529T possibly damaging Het
Tgfbr2 A T 9: 116,174,967 I24N possibly damaging Het
Tgm1 T C 14: 55,709,397 T385A probably damaging Het
Tgm2 T C 2: 158,131,459 N244S probably benign Het
Thoc5 T C 11: 4,914,517 probably benign Het
Tmc2 A T 2: 130,234,869 I372F probably damaging Het
Tnrc6a A G 7: 123,171,297 D222G probably damaging Het
Trhde T G 10: 114,800,603 N233T probably benign Het
Tstd3 T C 4: 21,759,475 Y99C probably damaging Het
Ttc22 A T 4: 106,639,040 D429V possibly damaging Het
Ugcg A G 4: 59,207,775 N38S probably benign Het
Ush2a A G 1: 188,728,203 I2554V possibly damaging Het
Usp16 A G 16: 87,479,316 D513G probably damaging Het
Vip T C 10: 5,644,992 probably null Het
Vmn1r4 A G 6: 56,957,038 I176V probably benign Het
Zfp804b T C 5: 6,769,806 T1050A probably damaging Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86869206 unclassified probably null
IGL00809:Stab2 APN 10 86848174 splice site probably benign
IGL00911:Stab2 APN 10 86969753 missense probably damaging 1.00
IGL01347:Stab2 APN 10 86901703 splice site probably null
IGL01411:Stab2 APN 10 86980008 splice site probably benign
IGL01503:Stab2 APN 10 86940613 splice site probably benign
IGL01599:Stab2 APN 10 86922895 missense probably damaging 1.00
IGL01635:Stab2 APN 10 86981128 missense probably benign 0.04
IGL01640:Stab2 APN 10 86954171 missense probably benign 0.09
IGL01671:Stab2 APN 10 86969277 missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86871831 missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86967650 missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86859742 unclassified probably null
IGL02600:Stab2 APN 10 86954259 missense probably damaging 1.00
IGL02666:Stab2 APN 10 86850902 missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86846163 splice site probably benign
IGL02709:Stab2 APN 10 86846165 splice site probably benign
IGL02728:Stab2 APN 10 86856556 missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86950269 splice site probably benign
IGL02938:Stab2 APN 10 86871921 missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86996803 critical splice donor site probably null
IGL03238:Stab2 APN 10 86855121 missense probably damaging 1.00
IGL03402:Stab2 APN 10 86969301 missense probably benign 0.03
3-1:Stab2 UTSW 10 86869177 missense probably damaging 0.96
F6893:Stab2 UTSW 10 86855171 missense probably damaging 1.00
K7371:Stab2 UTSW 10 86943289 critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86867175 missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86861435 nonsense probably null
R0015:Stab2 UTSW 10 86843617 missense probably benign
R0254:Stab2 UTSW 10 86897960 missense probably benign
R0310:Stab2 UTSW 10 86967613 splice site probably benign
R0333:Stab2 UTSW 10 86841627 missense probably benign
R0391:Stab2 UTSW 10 86947144 missense probably benign 0.27
R0400:Stab2 UTSW 10 86872610 missense probably damaging 1.00
R0433:Stab2 UTSW 10 86843491 splice site probably benign
R0440:Stab2 UTSW 10 86949928 missense probably benign 0.23
R0743:Stab2 UTSW 10 86887895 missense probably damaging 1.00
R0847:Stab2 UTSW 10 86969871 missense probably benign 0.00
R0883:Stab2 UTSW 10 86924450 splice site probably benign
R1078:Stab2 UTSW 10 86907133 splice site probably null
R1118:Stab2 UTSW 10 86885718 unclassified probably null
R1119:Stab2 UTSW 10 86859755 missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86950301 missense probably damaging 0.98
R1440:Stab2 UTSW 10 86861367 unclassified probably null
R1550:Stab2 UTSW 10 86878926 missense probably benign 0.01
R1616:Stab2 UTSW 10 86885718 unclassified probably null
R1728:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1768:Stab2 UTSW 10 87003008 missense probably damaging 1.00
R1772:Stab2 UTSW 10 86954234 missense probably benign 0.06
R1784:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1892:Stab2 UTSW 10 86938049 missense probably damaging 0.99
R1957:Stab2 UTSW 10 86861470 missense probably benign 0.13
R1972:Stab2 UTSW 10 86960316 missense probably damaging 0.99
R1975:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1976:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1996:Stab2 UTSW 10 87003031 missense probably damaging 1.00
R2085:Stab2 UTSW 10 86954159 missense probably damaging 1.00
R2149:Stab2 UTSW 10 86865040 nonsense probably null
R2169:Stab2 UTSW 10 86887862 missense probably damaging 1.00
R2201:Stab2 UTSW 10 86940639 missense probably benign 0.22
R2296:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86969319 missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86934840 splice site probably benign
R2696:Stab2 UTSW 10 86861499 missense probably benign 0.45
R2883:Stab2 UTSW 10 86967686 missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86861461 missense probably damaging 1.00
R3711:Stab2 UTSW 10 86866708 missense probably damaging 1.00
R3787:Stab2 UTSW 10 86969277 missense possibly damaging 0.50
R3834:Stab2 UTSW 10 86949912 missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86878886 missense probably damaging 0.97
R3979:Stab2 UTSW 10 86863456 missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86858124 missense probably damaging 1.00
R4088:Stab2 UTSW 10 86922185 missense probably damaging 1.00
R4151:Stab2 UTSW 10 87002983 missense probably benign 0.12
R4190:Stab2 UTSW 10 86878944 missense probably damaging 0.98
R4556:Stab2 UTSW 10 86967679 missense possibly damaging 0.95
R4773:Stab2 UTSW 10 86907371 nonsense probably null
R4825:Stab2 UTSW 10 86947147 missense probably benign 0.08
R4865:Stab2 UTSW 10 86843500 unclassified probably null
R4871:Stab2 UTSW 10 86942235 missense probably damaging 0.99
R4943:Stab2 UTSW 10 86954162 missense probably damaging 0.99
R4981:Stab2 UTSW 10 86960223 missense probably benign
R4994:Stab2 UTSW 10 86949907 missense probably benign
R4999:Stab2 UTSW 10 86937909 missense probably damaging 0.97
R5061:Stab2 UTSW 10 86907385 missense probably damaging 1.00
R5072:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5073:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5074:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5134:Stab2 UTSW 10 86871810 unclassified probably null
R5213:Stab2 UTSW 10 86907197 missense probably damaging 0.99
R5508:Stab2 UTSW 10 86960279 missense probably benign 0.01
R5530:Stab2 UTSW 10 86947162 missense probably benign 0.04
R5540:Stab2 UTSW 10 86848125 missense probably benign 0.30
R5839:Stab2 UTSW 10 86872691 missense probably damaging 0.97
R5949:Stab2 UTSW 10 86969849 missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86938042 missense probably damaging 0.99
R6019:Stab2 UTSW 10 87003022 missense probably benign 0.00
R6116:Stab2 UTSW 10 86907190 missense probably damaging 1.00
R6131:Stab2 UTSW 10 86883778 unclassified probably null
R6209:Stab2 UTSW 10 86923003 missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86907161 missense probably damaging 1.00
R6433:Stab2 UTSW 10 86901567 splice site probably null
R6787:Stab2 UTSW 10 86919084 missense probably benign 0.07
R6841:Stab2 UTSW 10 86942190 missense probably damaging 1.00
R6873:Stab2 UTSW 10 86861366 critical splice donor site probably null
R7025:Stab2 UTSW 10 86850837 missense probably damaging 1.00
R7043:Stab2 UTSW 10 86870246 missense probably damaging 0.99
R7047:Stab2 UTSW 10 86858152 missense probably damaging 1.00
R7107:Stab2 UTSW 10 86905592 missense possibly damaging 0.96
R7214:Stab2 UTSW 10 86899841 missense probably damaging 0.99
R7271:Stab2 UTSW 10 87003108 splice site probably null
R7291:Stab2 UTSW 10 86946220 missense probably damaging 0.96
R7336:Stab2 UTSW 10 86969185 nonsense probably null
R7432:Stab2 UTSW 10 86885683 missense probably damaging 0.99
X0023:Stab2 UTSW 10 86922198 critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86887816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTGAAAGCTAACTCAGGCCAG -3'
(R):5'- CTGCCCTCAGACAAGGGACTAAAAG -3'

Sequencing Primer
(F):5'- TAACTCAGGCCAGATCCAAATC -3'
(R):5'- ggagagagagagagagagagag -3'
Posted On2014-05-23