Incidental Mutation 'R1776:Adamts19'
ID197071
Institutional Source Beutler Lab
Gene Symbol Adamts19
Ensembl Gene ENSMUSG00000053441
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19
SynonymsD230034E10Rik
MMRRC Submission 039807-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R1776 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location58836764-59053678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58954620 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 574 (I574N)
Ref Sequence ENSEMBL: ENSMUSP00000050535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052907]
Predicted Effect probably damaging
Transcript: ENSMUST00000052907
AA Change: I574N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: I574N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 57 84 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
Pfam:Pep_M12B_propep 131 276 1.6e-21 PFAM
Pfam:Reprolysin_5 326 523 1.7e-13 PFAM
Pfam:Reprolysin_4 328 544 2e-10 PFAM
Pfam:Reprolysin 328 548 9e-22 PFAM
Pfam:Reprolysin_2 346 537 1.6e-9 PFAM
Pfam:Reprolysin_3 350 496 3.4e-12 PFAM
low complexity region 551 562 N/A INTRINSIC
TSP1 639 689 5.68e-9 SMART
Pfam:ADAM_spacer1 793 903 1.1e-31 PFAM
TSP1 922 980 4.95e-2 SMART
TSP1 982 1040 4.95e-2 SMART
TSP1 1042 1086 1.62e-4 SMART
TSP1 1093 1147 1.03e-6 SMART
Pfam:PLAC 1167 1199 4.2e-9 PFAM
Meta Mutation Damage Score 0.38 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T C 10: 70,875,228 noncoding transcript Het
9430097D07Rik T C 2: 32,574,755 probably benign Het
A2m C G 6: 121,641,424 F225L probably damaging Het
AI314180 A G 4: 58,879,100 I63T probably damaging Het
Ankfn1 T C 11: 89,526,474 D104G possibly damaging Het
Ankhd1 T A 18: 36,647,308 N1804K probably benign Het
Ankle1 G T 8: 71,409,274 V474F probably damaging Het
Arfgap3 A G 15: 83,343,139 V24A probably benign Het
Asph A T 4: 9,598,773 S149R probably damaging Het
Cass4 A T 2: 172,427,695 I568L probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdx1 G A 18: 61,036,014 A36V probably benign Het
Cep57 A T 9: 13,818,874 S123T probably damaging Het
Clca3a2 T A 3: 144,813,920 Q231L probably damaging Het
Clcnkb T C 4: 141,415,189 probably benign Het
Crabp2 C A 3: 87,952,994 T125K probably benign Het
Dennd3 A G 15: 73,555,101 T776A possibly damaging Het
Dnajb6 T C 5: 29,785,093 probably benign Het
Dsp T A 13: 38,196,617 I1847N probably damaging Het
Dync1h1 T C 12: 110,632,928 probably benign Het
Fbn1 A C 2: 125,321,734 F2067L possibly damaging Het
Fbxo16 T A 14: 65,295,386 probably null Het
Gm3604 C A 13: 62,370,074 G157* probably null Het
Gm5250 A G 1: 13,062,340 noncoding transcript Het
Gpam A G 19: 55,078,575 S503P possibly damaging Het
Herc4 T A 10: 63,264,171 C124* probably null Het
Ift27 T C 15: 78,165,981 D76G probably null Het
Igdcc3 C T 9: 65,182,752 Q550* probably null Het
Igsf6 T A 7: 121,068,299 I165F probably damaging Het
Il31ra T C 13: 112,541,239 I173M probably damaging Het
Kbtbd6 G A 14: 79,452,605 D247N probably benign Het
Kcnq2 T A 2: 181,100,557 T394S probably benign Het
Mia2 A G 12: 59,149,575 probably benign Het
Mvp T C 7: 126,992,761 Q419R probably benign Het
Mylk A G 16: 34,952,782 D1250G probably benign Het
Necab1 A G 4: 15,111,267 Y54H probably damaging Het
Nlk T A 11: 78,587,027 M297L probably benign Het
Nsl1 G T 1: 191,063,188 M50I probably benign Het
Numa1 A G 7: 102,011,050 T441A probably damaging Het
Ofd1 A G X: 166,406,006 Y755H probably benign Het
Olfr810 C T 10: 129,791,131 V153I probably benign Het
Olfr870 G A 9: 20,170,809 T254I probably benign Het
Olfr934 G A 9: 38,982,894 S50F probably damaging Het
Ovgp1 A T 3: 105,977,798 H151L possibly damaging Het
Pigz G A 16: 31,944,579 E152K probably damaging Het
Plxna1 A T 6: 89,335,464 D779E probably benign Het
Ppil4 A T 10: 7,810,437 E353V probably benign Het
Ptprq C T 10: 107,685,089 G741S probably damaging Het
Rplp0 T C 5: 115,562,465 Y231H probably benign Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rundc3b T C 5: 8,579,050 E117G probably damaging Het
Ryr2 A C 13: 11,745,176 probably null Het
Ryr3 A T 2: 112,957,253 M198K probably damaging Het
Sdhd T C 9: 50,597,200 K122R probably benign Het
Senp2 T C 16: 22,043,060 probably benign Het
Setd3 C A 12: 108,165,161 G2V probably damaging Het
Sfxn5 A G 6: 85,267,945 probably benign Het
She T A 3: 89,832,038 S179T possibly damaging Het
Slc24a2 G A 4: 87,176,289 T331I probably benign Het
Slc45a3 T C 1: 131,976,956 W6R possibly damaging Het
Slc9a4 T C 1: 40,629,287 S697P probably benign Het
Soat1 C T 1: 156,442,421 V143I probably benign Het
Sp8 T A 12: 118,849,567 F386I probably damaging Het
Spata31d1b A G 13: 59,716,567 T510A probably benign Het
Srgap2 T A 1: 131,411,850 I125F probably damaging Het
Stab2 T A 10: 86,957,816 I472F possibly damaging Het
Taar7f C T 10: 24,049,648 R47C probably benign Het
Tbc1d19 T A 5: 53,889,311 probably null Het
Tbc1d21 T A 9: 58,366,728 probably benign Het
Tcaf1 A G 6: 42,678,455 I529T possibly damaging Het
Tgfbr2 A T 9: 116,174,967 I24N possibly damaging Het
Tgm1 T C 14: 55,709,397 T385A probably damaging Het
Tgm2 T C 2: 158,131,459 N244S probably benign Het
Thoc5 T C 11: 4,914,517 probably benign Het
Tmc2 A T 2: 130,234,869 I372F probably damaging Het
Tnrc6a A G 7: 123,171,297 D222G probably damaging Het
Trhde T G 10: 114,800,603 N233T probably benign Het
Tstd3 T C 4: 21,759,475 Y99C probably damaging Het
Ttc22 A T 4: 106,639,040 D429V possibly damaging Het
Ugcg A G 4: 59,207,775 N38S probably benign Het
Ush2a A G 1: 188,728,203 I2554V possibly damaging Het
Usp16 A G 16: 87,479,316 D513G probably damaging Het
Vip T C 10: 5,644,992 probably null Het
Vmn1r4 A G 6: 56,957,038 I176V probably benign Het
Zfp804b T C 5: 6,769,806 T1050A probably damaging Het
Other mutations in Adamts19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Adamts19 APN 18 59024465 missense probably damaging 1.00
IGL00331:Adamts19 APN 18 59007325 splice site probably benign
IGL00970:Adamts19 APN 18 59011077 missense possibly damaging 0.82
IGL01328:Adamts19 APN 18 59048882 missense possibly damaging 0.89
IGL01385:Adamts19 APN 18 58972779 missense probably damaging 0.98
IGL01529:Adamts19 APN 18 58963463 missense probably damaging 0.99
IGL01535:Adamts19 APN 18 58968819 missense probably benign 0.00
IGL01557:Adamts19 APN 18 58968720 splice site probably null
IGL01705:Adamts19 APN 18 59032966 missense possibly damaging 0.91
IGL01803:Adamts19 APN 18 58952469 missense probably damaging 1.00
IGL02116:Adamts19 APN 18 58837499 missense probably benign
IGL02131:Adamts19 APN 18 59052660 missense probably damaging 1.00
IGL02312:Adamts19 APN 18 58927297 missense probably damaging 1.00
IGL02755:Adamts19 APN 18 58969933 missense probably benign 0.25
IGL02866:Adamts19 APN 18 59048842 missense possibly damaging 0.80
IGL02964:Adamts19 APN 18 58988965 missense probably damaging 1.00
IGL02982:Adamts19 APN 18 59024518 missense probably damaging 1.00
IGL03040:Adamts19 APN 18 58903008 missense probably benign 0.05
R0081:Adamts19 UTSW 18 58903065 critical splice donor site probably null
R0194:Adamts19 UTSW 18 59011148 missense probably null 1.00
R0195:Adamts19 UTSW 18 58969870 splice site probably benign
R0541:Adamts19 UTSW 18 58927300 critical splice donor site probably null
R0659:Adamts19 UTSW 18 59007493 splice site probably benign
R0967:Adamts19 UTSW 18 58972740 nonsense probably null
R1512:Adamts19 UTSW 18 59048845 missense possibly damaging 0.89
R1536:Adamts19 UTSW 18 59052615 missense probably damaging 1.00
R1582:Adamts19 UTSW 18 58969941 missense probably damaging 0.98
R1629:Adamts19 UTSW 18 58954619 missense probably damaging 0.97
R1653:Adamts19 UTSW 18 58890293 missense probably benign 0.00
R1718:Adamts19 UTSW 18 58972825 missense probably damaging 1.00
R1733:Adamts19 UTSW 18 59031929 missense probably damaging 1.00
R1753:Adamts19 UTSW 18 59007372 missense possibly damaging 0.78
R1905:Adamts19 UTSW 18 59032945 missense possibly damaging 0.92
R1958:Adamts19 UTSW 18 58970006 missense probably benign 0.09
R1994:Adamts19 UTSW 18 58972831 critical splice donor site probably null
R2177:Adamts19 UTSW 18 58954554 missense possibly damaging 0.66
R3730:Adamts19 UTSW 18 58900910 missense probably damaging 1.00
R4342:Adamts19 UTSW 18 58942500 missense probably damaging 1.00
R4772:Adamts19 UTSW 18 58837776 missense possibly damaging 0.85
R4822:Adamts19 UTSW 18 58890284 missense probably damaging 1.00
R4891:Adamts19 UTSW 18 59033000 missense probably damaging 1.00
R5112:Adamts19 UTSW 18 59031804 nonsense probably null
R5116:Adamts19 UTSW 18 58902994 missense possibly damaging 0.52
R5205:Adamts19 UTSW 18 58968808 missense probably damaging 1.00
R5765:Adamts19 UTSW 18 59052582 missense probably damaging 1.00
R5781:Adamts19 UTSW 18 58837968 missense possibly damaging 0.59
R5792:Adamts19 UTSW 18 58837512 missense possibly damaging 0.49
R6082:Adamts19 UTSW 18 58968774 missense probably benign 0.18
R6088:Adamts19 UTSW 18 58902102 missense probably damaging 1.00
R7060:Adamts19 UTSW 18 58837640 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCTTCAATGGCAGAGCTACTAAGTGTT -3'
(R):5'- GTGGCCCTCAGGAAGGTTGTAGA -3'

Sequencing Primer
(F):5'- tCACGAAACTGTTTCTTCTAAGAAAG -3'
(R):5'- CTGGGTTGGATTGCCCAAATAC -3'
Posted On2014-05-23