Incidental Mutation 'R1777:Golga2'
ID197079
Institutional Source Beutler Lab
Gene Symbol Golga2
Ensembl Gene ENSMUSG00000002546
Gene Namegolgi autoantigen, golgin subfamily a, 2
SynonymsGM130
MMRRC Submission 039808-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.473) question?
Stock #R1777 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location32287384-32307921 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 32305470 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078352] [ENSMUST00000081670] [ENSMUST00000091089] [ENSMUST00000100194] [ENSMUST00000113350] [ENSMUST00000113352] [ENSMUST00000113365] [ENSMUST00000113377] [ENSMUST00000129156] [ENSMUST00000129193] [ENSMUST00000139624] [ENSMUST00000201433] [ENSMUST00000201440] [ENSMUST00000201494] [ENSMUST00000202578]
Predicted Effect probably benign
Transcript: ENSMUST00000078352
SMART Domains Protein: ENSMUSP00000077461
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000081670
SMART Domains Protein: ENSMUSP00000080374
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
coiled coil region 105 173 N/A INTRINSIC
low complexity region 189 202 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
Pfam:GOLGA2L5 337 955 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091089
SMART Domains Protein: ENSMUSP00000088618
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 516 623 2.7e-10 SMART
GED 650 741 9.51e-32 SMART
low complexity region 743 757 N/A INTRINSIC
low complexity region 779 812 N/A INTRINSIC
low complexity region 815 826 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100194
SMART Domains Protein: ENSMUSP00000097768
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 45 51 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
coiled coil region 176 244 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 372 384 N/A INTRINSIC
Pfam:GOLGA2L5 408 1026 2.1e-299 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113350
SMART Domains Protein: ENSMUSP00000108977
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113352
SMART Domains Protein: ENSMUSP00000108979
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113365
SMART Domains Protein: ENSMUSP00000108992
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
low complexity region 851 861 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113377
SMART Domains Protein: ENSMUSP00000109004
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 45 51 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
coiled coil region 149 217 N/A INTRINSIC
low complexity region 233 246 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:GOLGA2L5 381 999 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126276
Predicted Effect probably benign
Transcript: ENSMUST00000129156
SMART Domains Protein: ENSMUSP00000118914
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
PH 1 96 2.75e-2 SMART
GED 123 214 9.51e-32 SMART
low complexity region 216 230 N/A INTRINSIC
low complexity region 239 258 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129193
SMART Domains Protein: ENSMUSP00000115003
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 31 37 N/A INTRINSIC
low complexity region 57 72 N/A INTRINSIC
coiled coil region 136 176 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
coiled coil region 226 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131712
SMART Domains Protein: ENSMUSP00000114169
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
coiled coil region 106 146 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
coiled coil region 196 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139291
SMART Domains Protein: ENSMUSP00000115523
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
Pfam:GED 1 43 3.3e-7 PFAM
low complexity region 45 59 N/A INTRINSIC
low complexity region 81 114 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139624
SMART Domains Protein: ENSMUSP00000122679
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146544
Predicted Effect probably benign
Transcript: ENSMUST00000155269
SMART Domains Protein: ENSMUSP00000116054
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
GED 1 53 1.63e-1 SMART
low complexity region 55 69 N/A INTRINSIC
low complexity region 91 124 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201433
SMART Domains Protein: ENSMUSP00000144264
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
low complexity region 851 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201440
SMART Domains Protein: ENSMUSP00000144309
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
Pfam:GED 1 41 5.9e-7 PFAM
low complexity region 43 57 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201494
SMART Domains Protein: ENSMUSP00000144145
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 6.9e-180 SMART
Pfam:Dynamin_M 413 473 2.1e-14 PFAM
PH 491 598 1.2e-12 SMART
GED 625 716 6.1e-34 SMART
low complexity region 718 732 N/A INTRINSIC
low complexity region 754 787 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 822 832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202578
SMART Domains Protein: ENSMUSP00000143955
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein has been postulated to play roles in the stacking of Golgi cisternae and in vesicular transport. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of these variants has not been determined. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik T A 1: 16,078,589 D111V possibly damaging Het
Ap2a1 G A 7: 44,904,152 T597M probably damaging Het
Arhgap25 A G 6: 87,463,307 S364P probably benign Het
Atp6v1a G T 16: 44,114,705 Y40* probably null Het
Cdh1 T A 8: 106,656,835 H235Q probably damaging Het
Cntln A G 4: 85,130,679 E1376G probably benign Het
Cntnap5b T A 1: 100,370,078 S781T probably benign Het
Cpne4 A G 9: 104,872,688 T64A probably damaging Het
Ctsg T C 14: 56,100,601 Y179C probably damaging Het
Cx3cr1 A G 9: 120,051,593 Y248H probably damaging Het
Dhx37 T C 5: 125,429,931 E167G probably benign Het
Dnajc21 C A 15: 10,449,607 A443S probably benign Het
Drd5 T C 5: 38,320,161 S166P probably damaging Het
Dscaml1 T C 9: 45,683,756 L719P possibly damaging Het
Eif2ak4 T C 2: 118,430,839 I542T probably damaging Het
Ephb3 G A 16: 21,217,235 G291E probably damaging Het
Eva1a T A 6: 82,092,156 Y155N probably damaging Het
Exog C T 9: 119,449,818 P189L probably damaging Het
Fam13b A G 18: 34,457,760 V455A possibly damaging Het
Fam192a T C 8: 94,588,811 E31G probably damaging Het
Fam35a C A 14: 34,268,173 V259L probably benign Het
Fmn2 C A 1: 174,581,922 Q574K unknown Het
Gm10037 A T 13: 67,833,865 R65S probably benign Het
Gm6871 A T 7: 41,545,719 S531R probably benign Het
Hydin C T 8: 110,589,571 P4365L probably benign Het
Ints8 A T 4: 11,225,600 probably null Het
Kbtbd12 A C 6: 88,618,060 S263A probably benign Het
Kcng4 T C 8: 119,633,487 D50G probably benign Het
Klhl18 A T 9: 110,437,401 C217S probably benign Het
Klk1b4 A G 7: 44,207,451 probably benign Het
Klk7 G A 7: 43,813,329 C186Y probably damaging Het
Krit1 T C 5: 3,836,799 Y635H probably damaging Het
Lipo4 A T 19: 33,499,321 D342E probably damaging Het
Lsm14b T G 2: 180,031,795 D199E probably benign Het
Map3k4 A T 17: 12,271,730 N271K possibly damaging Het
Mast1 T A 8: 84,912,068 N1544I probably benign Het
Megf6 T A 4: 154,270,690 C1487* probably null Het
Mlh3 C A 12: 85,268,754 K219N possibly damaging Het
Mtmr4 A G 11: 87,602,830 K305E probably damaging Het
Myo15 A G 11: 60,514,936 M3105V probably benign Het
Nbas A T 12: 13,513,562 I1958F probably benign Het
Nepro A T 16: 44,735,853 Q458L probably damaging Het
Olfr1309 T A 2: 111,983,697 I126L possibly damaging Het
Olfr198 A G 16: 59,202,016 S137P probably benign Het
Olfr295 T A 7: 86,586,064 I263N probably benign Het
Olfr583 T C 7: 103,051,376 I26T probably benign Het
Olfr741 T A 14: 50,486,300 F281I probably benign Het
Olfr874 A G 9: 37,746,311 Y59C possibly damaging Het
Opa3 T C 7: 19,244,912 Y101H probably damaging Het
Pate3 T C 9: 35,648,116 N2D probably benign Het
Pcdhb21 T A 18: 37,515,718 D633E possibly damaging Het
Pgm1 C T 5: 64,127,782 P589L probably benign Het
Pigg T A 5: 108,317,391 D163E probably damaging Het
Polq A G 16: 37,060,224 T638A possibly damaging Het
Prmt3 T A 7: 49,798,346 M268K possibly damaging Het
Prmt9 T C 8: 77,565,108 C370R probably benign Het
Prss57 A T 10: 79,787,385 V76E possibly damaging Het
Pzp T C 6: 128,490,572 E1089G possibly damaging Het
Qars T A 9: 108,508,201 probably null Het
Ralgapb T C 2: 158,462,195 Y625H probably damaging Het
Rgl2 G A 17: 33,931,744 D59N probably benign Het
Robo1 T G 16: 73,004,667 W1060G probably benign Het
Scaper A T 9: 55,864,546 V362E probably benign Het
Schip1 T C 3: 68,617,684 F131S probably damaging Het
Sh2b2 A T 5: 136,227,422 V252D probably damaging Het
Slc17a6 A T 7: 51,646,209 H199L possibly damaging Het
Slc29a1 A G 17: 45,587,308 Y325H probably damaging Het
Slc29a4 G T 5: 142,714,062 W156L probably damaging Het
Slc5a3 T A 16: 92,077,756 S234T probably benign Het
Srd5a3 T G 5: 76,149,783 V20G probably damaging Het
Stac A T 9: 111,604,082 S223T possibly damaging Het
Sytl2 A T 7: 90,403,052 T766S probably benign Het
Tas2r102 A G 6: 132,762,291 D54G probably benign Het
Tbpl1 A G 10: 22,707,843 V105A probably damaging Het
Tenm3 G T 8: 48,417,179 P193Q probably benign Het
Tes G A 6: 17,104,755 V403M probably benign Het
Tgfbr2 A C 9: 116,109,880 I318S probably damaging Het
Tgfbr3 C A 5: 107,136,930 V618L probably benign Het
Tmc1 C T 19: 20,816,109 probably null Het
Tmem132a G A 19: 10,858,506 H887Y probably damaging Het
Tmem43 C A 6: 91,477,330 S33* probably null Het
Tob1 A G 11: 94,213,754 K39E probably damaging Het
Unc79 T A 12: 103,112,455 D1433E probably damaging Het
Usp25 T C 16: 77,081,554 M622T probably damaging Het
Vmn1r158 A T 7: 22,790,430 L118Q probably damaging Het
Vmn1r217 T A 13: 23,114,325 I136L probably benign Het
Vmn2r15 A T 5: 109,294,270 I99K possibly damaging Het
Vwa7 T A 17: 35,024,948 V786E probably damaging Het
Xkr5 A G 8: 18,939,132 F248S probably benign Het
Zcchc6 A T 13: 59,791,821 H705Q probably damaging Het
Zzef1 A T 11: 72,910,272 K2444M probably damaging Het
Other mutations in Golga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Golga2 APN 2 32305214 missense probably benign 0.01
IGL01561:Golga2 APN 2 32296677 missense probably benign 0.00
IGL02396:Golga2 APN 2 32298644 splice site probably benign
IGL02636:Golga2 APN 2 32296723 critical splice donor site probably null
IGL02712:Golga2 APN 2 32304213 missense probably damaging 1.00
IGL03172:Golga2 APN 2 32292156 missense probably benign 0.04
IGL03193:Golga2 APN 2 32305008 missense probably damaging 1.00
R0050:Golga2 UTSW 2 32292127 missense probably damaging 0.96
R0050:Golga2 UTSW 2 32292127 missense probably damaging 0.96
R0265:Golga2 UTSW 2 32304952 splice site probably null
R0440:Golga2 UTSW 2 32302933 missense probably damaging 1.00
R0644:Golga2 UTSW 2 32297521 missense probably damaging 1.00
R0825:Golga2 UTSW 2 32304791 missense probably damaging 1.00
R1179:Golga2 UTSW 2 32303695 missense possibly damaging 0.50
R1447:Golga2 UTSW 2 32297776 missense possibly damaging 0.69
R1459:Golga2 UTSW 2 32297795 unclassified probably null
R1517:Golga2 UTSW 2 32305984 nonsense probably null
R1522:Golga2 UTSW 2 32302204 missense probably benign 0.01
R1599:Golga2 UTSW 2 32303173 missense probably benign 0.00
R1702:Golga2 UTSW 2 32299275 missense probably damaging 1.00
R1716:Golga2 UTSW 2 32302897 missense probably damaging 1.00
R1781:Golga2 UTSW 2 32306576 missense probably damaging 1.00
R2229:Golga2 UTSW 2 32306465 missense probably benign 0.06
R2484:Golga2 UTSW 2 32304770 missense probably benign 0.32
R2972:Golga2 UTSW 2 32305659 missense probably benign 0.16
R3411:Golga2 UTSW 2 32302942 missense probably damaging 0.98
R3851:Golga2 UTSW 2 32305611 missense probably benign 0.30
R3852:Golga2 UTSW 2 32305611 missense probably benign 0.30
R4130:Golga2 UTSW 2 32288166 missense probably benign 0.07
R4783:Golga2 UTSW 2 32297156 missense probably damaging 1.00
R4784:Golga2 UTSW 2 32297156 missense probably damaging 1.00
R4785:Golga2 UTSW 2 32297156 missense probably damaging 1.00
R4808:Golga2 UTSW 2 32303214 missense probably benign 0.00
R5103:Golga2 UTSW 2 32303746 missense probably benign 0.09
R5261:Golga2 UTSW 2 32304154 missense probably benign 0.02
R5315:Golga2 UTSW 2 32303761 missense probably damaging 1.00
R5508:Golga2 UTSW 2 32288187 nonsense probably null
R5627:Golga2 UTSW 2 32306047 nonsense probably null
R5921:Golga2 UTSW 2 32297755 missense probably benign 0.00
R6678:Golga2 UTSW 2 32299060 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGGAGACAACCTACTGTCTGCC -3'
(R):5'- GCTGAATGCAGCAATGTTCAAGCTC -3'

Sequencing Primer
(F):5'- AGGAGGTTCCTCAGTCGAG -3'
(R):5'- TCCTCAGATGCAGAGTCATCC -3'
Posted On2014-05-23