Incidental Mutation 'R0082:Tie1'
ID19713
Institutional Source Beutler Lab
Gene Symbol Tie1
Ensembl Gene ENSMUSG00000033191
Gene Nametyrosine kinase with immunoglobulin-like and EGF-like domains 1
SynonymsTIE, D430008P04Rik, tie-1
MMRRC Submission 038369-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0082 (G1)
Quality Score158
Status Validated
Chromosome4
Chromosomal Location118471191-118490061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118484353 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 254 (E254V)
Ref Sequence ENSEMBL: ENSMUSP00000139279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047421] [ENSMUST00000184261]
Predicted Effect probably damaging
Transcript: ENSMUST00000047421
AA Change: E254V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037129
Gene: ENSMUSG00000033191
AA Change: E254V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 129 211 1.58e-1 SMART
EGF 221 254 1.47e-3 SMART
EGF_like 265 301 7.23e1 SMART
EGF 312 343 8.52e0 SMART
IG 355 442 1.92e0 SMART
FN3 445 528 2.68e-2 SMART
FN3 544 627 4.1e0 SMART
FN3 640 722 6.95e-10 SMART
transmembrane domain 760 782 N/A INTRINSIC
TyrKc 835 1103 5.05e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153286
Predicted Effect probably damaging
Transcript: ENSMUST00000184261
AA Change: E254V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139279
Gene: ENSMUSG00000033191
AA Change: E254V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 129 211 1.58e-1 SMART
EGF 221 254 1.47e-3 SMART
EGF_like 265 301 7.23e1 SMART
EGF 312 343 8.52e0 SMART
IG 355 442 1.92e0 SMART
FN3 445 528 2.68e-2 SMART
FN3 544 627 4.1e0 SMART
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.3%
  • 10x: 91.7%
  • 20x: 73.7%
Validation Efficiency 94% (136/144)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine protein kinase family. The encoded protein plays a critical role in angiogenesis and blood vessel stability by inhibiting angiopoietin 1 signaling through the endothelial receptor tyrosine kinase Tie2. Ectodomain cleavage of the encoded protein relieves inhibition of Tie2 and is mediated by multiple factors including vascular endothelial growth factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in embryonic or neonatal lethality, hemorrhages, edema, increased vascular branching, and abnormal vascular endothelial cell development. Mice homozygous for a hypomorphic allele exhibit dilated and disorganized lymphatic vessel, edema, and hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik T C 9: 51,101,802 T57A probably benign Het
Adam17 A C 12: 21,329,048 probably benign Het
Adcy1 T C 11: 7,149,497 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Ankrd33b T C 15: 31,297,789 N274S probably benign Het
Arhgef1 C T 7: 24,912,605 Q100* probably null Het
BC030499 T C 11: 78,293,558 S244P probably damaging Het
Ccdc180 A G 4: 45,896,205 D118G probably null Het
Cdh23 T C 10: 60,312,587 D2667G probably damaging Het
Cdh4 A T 2: 179,894,188 N844I possibly damaging Het
Cep57 T C 9: 13,810,876 probably benign Het
Dnah7a A T 1: 53,518,708 D2182E probably damaging Het
Dync1h1 A G 12: 110,636,446 T2174A probably benign Het
Eef1akmt2 T A 7: 132,851,472 R44* probably null Het
Evpl T A 11: 116,235,003 I43F probably damaging Het
F13a1 G T 13: 36,988,953 P151Q probably damaging Het
Fam173a T C 17: 25,791,574 I89V probably benign Het
Galnt5 A T 2: 57,999,035 I216F possibly damaging Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gpr139 T A 7: 119,145,045 T106S probably benign Het
Hoxb3 A G 11: 96,344,271 D8G probably damaging Het
Hpse T C 5: 100,692,262 K330E possibly damaging Het
Kcmf1 G T 6: 72,850,487 probably null Het
Klra2 T C 6: 131,220,247 N263S possibly damaging Het
Klra8 T C 6: 130,125,055 D139G probably benign Het
Lrrc46 A C 11: 97,041,077 probably benign Het
Ly86 A T 13: 37,418,537 probably null Het
Mmp20 C T 9: 7,642,807 T214M probably benign Het
Olfr591 G T 7: 103,173,202 A145E probably benign Het
Olfr729 A T 14: 50,148,055 I273K probably damaging Het
Olfr786 T C 10: 129,437,271 I153T possibly damaging Het
Olfr799 G A 10: 129,647,653 C175Y probably benign Het
Pigg A G 5: 108,312,885 probably benign Het
Polq C A 16: 37,017,257 T177K probably benign Het
Pomgnt2 A T 9: 121,982,260 V485E probably damaging Het
Ppip5k2 A T 1: 97,759,332 C49* probably null Het
Prkrip1 T C 5: 136,197,828 N53D possibly damaging Het
Prrc2b T C 2: 32,212,298 probably benign Het
Qprt T C 7: 127,108,186 E246G probably damaging Het
Rpl9 A G 5: 65,388,652 V167A probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sgsm1 T C 5: 113,288,836 I43V probably benign Het
Slc38a7 A G 8: 95,840,481 probably benign Het
Slc8b1 A G 5: 120,524,200 probably benign Het
Sp2 T C 11: 96,961,699 Y133C probably damaging Het
Spdye4b A T 5: 143,195,675 D95V probably damaging Het
Srek1 T C 13: 103,743,686 T455A unknown Het
Stox2 A T 8: 47,203,282 probably benign Het
Synrg T A 11: 83,987,910 probably benign Het
Tmem97 G T 11: 78,542,588 F160L probably damaging Het
Utp6 A T 11: 79,953,631 H189Q possibly damaging Het
Vip T A 10: 5,644,953 *172R probably null Het
Wdr91 T C 6: 34,906,685 R132G possibly damaging Het
Wipi1 T C 11: 109,578,284 probably benign Het
Zfp445 A G 9: 122,852,356 V840A probably damaging Het
Other mutations in Tie1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Tie1 APN 4 118476098 missense probably damaging 1.00
IGL01679:Tie1 APN 4 118482739 missense probably benign 0.00
IGL01821:Tie1 APN 4 118484638 missense probably damaging 0.99
IGL01892:Tie1 APN 4 118475918 missense probably benign
IGL02101:Tie1 APN 4 118472798 missense probably benign 0.42
IGL02411:Tie1 APN 4 118486563 nonsense probably null
IGL02421:Tie1 APN 4 118486394 missense probably damaging 1.00
IGL02892:Tie1 APN 4 118486282 missense probably damaging 1.00
IGL03294:Tie1 APN 4 118480223 missense probably damaging 1.00
IGL03346:Tie1 APN 4 118472828 missense probably damaging 1.00
R0064:Tie1 UTSW 4 118489701 missense possibly damaging 0.94
R0067:Tie1 UTSW 4 118476280 splice site probably benign
R0080:Tie1 UTSW 4 118484353 missense probably damaging 1.00
R0098:Tie1 UTSW 4 118486587 missense probably benign
R0329:Tie1 UTSW 4 118484727 missense probably benign 0.24
R0330:Tie1 UTSW 4 118484727 missense probably benign 0.24
R0410:Tie1 UTSW 4 118480569 missense probably damaging 1.00
R0472:Tie1 UTSW 4 118476147 missense possibly damaging 0.61
R0498:Tie1 UTSW 4 118479161 utr 3 prime probably benign
R0521:Tie1 UTSW 4 118476146 missense probably damaging 1.00
R0609:Tie1 UTSW 4 118476147 missense possibly damaging 0.61
R0675:Tie1 UTSW 4 118479769 nonsense probably null
R0830:Tie1 UTSW 4 118482663 missense probably damaging 1.00
R1541:Tie1 UTSW 4 118483873 missense probably damaging 0.99
R1604:Tie1 UTSW 4 118474407 missense probably damaging 1.00
R1731:Tie1 UTSW 4 118476263 missense probably damaging 1.00
R1751:Tie1 UTSW 4 118476176 missense possibly damaging 0.87
R1767:Tie1 UTSW 4 118476176 missense possibly damaging 0.87
R1953:Tie1 UTSW 4 118472790 critical splice donor site probably null
R1986:Tie1 UTSW 4 118478963 missense probably benign
R2141:Tie1 UTSW 4 118472811 nonsense probably null
R3150:Tie1 UTSW 4 118475825 missense probably damaging 1.00
R4235:Tie1 UTSW 4 118478405 nonsense probably null
R4599:Tie1 UTSW 4 118472634 missense probably benign 0.00
R4614:Tie1 UTSW 4 118479051 missense probably damaging 1.00
R4623:Tie1 UTSW 4 118486611 missense possibly damaging 0.71
R4638:Tie1 UTSW 4 118483842 missense probably benign 0.00
R4717:Tie1 UTSW 4 118486217 missense probably damaging 1.00
R4936:Tie1 UTSW 4 118484771 splice site silent
R4983:Tie1 UTSW 4 118483755 missense probably damaging 1.00
R5202:Tie1 UTSW 4 118480510 missense probably benign 0.01
R5234:Tie1 UTSW 4 118482762 missense probably benign 0.22
R5243:Tie1 UTSW 4 118482351 missense probably damaging 0.99
R5538:Tie1 UTSW 4 118486193 missense probably benign 0.10
R5881:Tie1 UTSW 4 118475603 missense possibly damaging 0.89
R6045:Tie1 UTSW 4 118484691 missense probably benign 0.05
R6073:Tie1 UTSW 4 118482390 missense probably benign
R6476:Tie1 UTSW 4 118472865 missense possibly damaging 0.82
R6820:Tie1 UTSW 4 118484386 missense probably damaging 1.00
R6961:Tie1 UTSW 4 118486205 missense probably damaging 1.00
R7022:Tie1 UTSW 4 118489653 missense probably benign 0.00
R7029:Tie1 UTSW 4 118484626 missense possibly damaging 0.93
R7147:Tie1 UTSW 4 118484413 missense probably damaging 1.00
R7249:Tie1 UTSW 4 118486228 missense probably benign 0.29
Z1088:Tie1 UTSW 4 118484429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAGAAGGTGAGACCTCTACAAC -3'
(R):5'- GCCACCATCAAGTGGCATCTACAG -3'

Sequencing Primer
(F):5'- GTGAGACCTCTACAACCTGCTG -3'
(R):5'- TGGCATCTACAGTGCCAC -3'
Posted On2013-04-11