Incidental Mutation 'R1777:Dscaml1'
ID197135
Institutional Source Beutler Lab
Gene Symbol Dscaml1
Ensembl Gene ENSMUSG00000032087
Gene NameDS cell adhesion molecule like 1
Synonyms4921507G06Rik, 4930435C18Rik
MMRRC Submission 039808-MU
Accession Numbers

Genbank: NM_001081270; MGI: 2150309

Is this an essential gene? Possibly essential (E-score: 0.559) question?
Stock #R1777 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location45426628-45753712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45683756 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 719 (L719P)
Ref Sequence ENSEMBL: ENSMUSP00000034592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034592]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034592
AA Change: L719P

PolyPhen 2 Score 0.576 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034592
Gene: ENSMUSG00000032087
AA Change: L719P

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 28 55 N/A INTRINSIC
IG_like 96 168 1.22e0 SMART
IG 189 277 1.15e-3 SMART
IGc2 296 359 2.54e-14 SMART
IGc2 385 451 8.12e-13 SMART
IGc2 478 550 9.55e-10 SMART
IGc2 575 640 9.78e-7 SMART
IGc2 666 734 5.93e-6 SMART
IGc2 760 832 6.75e-10 SMART
IG 853 943 1e-3 SMART
FN3 945 1029 6.64e-7 SMART
FN3 1045 1133 9.46e-12 SMART
FN3 1148 1234 3.2e-9 SMART
FN3 1249 1332 3.48e-10 SMART
IGc2 1363 1428 1.49e-11 SMART
FN3 1442 1522 3.42e-9 SMART
FN3 1537 1618 2.14e-1 SMART
low complexity region 1671 1683 N/A INTRINSIC
low complexity region 2018 2026 N/A INTRINSIC
low complexity region 2035 2069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216078
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ig superfamily of cell adhesion molecules and is involved in neuronal differentiation. The encoded membrane-bound protein localizes to the cell surface, where it forms aggregates that repel neuronal processes of the same cell type. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired self-avoidance in multiple cell types in the retina. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik T A 1: 16,078,589 D111V possibly damaging Het
Ap2a1 G A 7: 44,904,152 T597M probably damaging Het
Arhgap25 A G 6: 87,463,307 S364P probably benign Het
Atp6v1a G T 16: 44,114,705 Y40* probably null Het
Cdh1 T A 8: 106,656,835 H235Q probably damaging Het
Cntln A G 4: 85,130,679 E1376G probably benign Het
Cntnap5b T A 1: 100,370,078 S781T probably benign Het
Cpne4 A G 9: 104,872,688 T64A probably damaging Het
Ctsg T C 14: 56,100,601 Y179C probably damaging Het
Cx3cr1 A G 9: 120,051,593 Y248H probably damaging Het
Dhx37 T C 5: 125,429,931 E167G probably benign Het
Dnajc21 C A 15: 10,449,607 A443S probably benign Het
Drd5 T C 5: 38,320,161 S166P probably damaging Het
Eif2ak4 T C 2: 118,430,839 I542T probably damaging Het
Ephb3 G A 16: 21,217,235 G291E probably damaging Het
Eva1a T A 6: 82,092,156 Y155N probably damaging Het
Exog C T 9: 119,449,818 P189L probably damaging Het
Fam13b A G 18: 34,457,760 V455A possibly damaging Het
Fam192a T C 8: 94,588,811 E31G probably damaging Het
Fam35a C A 14: 34,268,173 V259L probably benign Het
Fmn2 C A 1: 174,581,922 Q574K unknown Het
Gm10037 A T 13: 67,833,865 R65S probably benign Het
Gm6871 A T 7: 41,545,719 S531R probably benign Het
Golga2 T A 2: 32,305,470 probably null Het
Hydin C T 8: 110,589,571 P4365L probably benign Het
Ints8 A T 4: 11,225,600 probably null Het
Kbtbd12 A C 6: 88,618,060 S263A probably benign Het
Kcng4 T C 8: 119,633,487 D50G probably benign Het
Klhl18 A T 9: 110,437,401 C217S probably benign Het
Klk1b4 A G 7: 44,207,451 probably benign Het
Klk7 G A 7: 43,813,329 C186Y probably damaging Het
Krit1 T C 5: 3,836,799 Y635H probably damaging Het
Lipo4 A T 19: 33,499,321 D342E probably damaging Het
Lsm14b T G 2: 180,031,795 D199E probably benign Het
Map3k4 A T 17: 12,271,730 N271K possibly damaging Het
Mast1 T A 8: 84,912,068 N1544I probably benign Het
Megf6 T A 4: 154,270,690 C1487* probably null Het
Mlh3 C A 12: 85,268,754 K219N possibly damaging Het
Mtmr4 A G 11: 87,602,830 K305E probably damaging Het
Myo15 A G 11: 60,514,936 M3105V probably benign Het
Nbas A T 12: 13,513,562 I1958F probably benign Het
Nepro A T 16: 44,735,853 Q458L probably damaging Het
Olfr1309 T A 2: 111,983,697 I126L possibly damaging Het
Olfr198 A G 16: 59,202,016 S137P probably benign Het
Olfr295 T A 7: 86,586,064 I263N probably benign Het
Olfr583 T C 7: 103,051,376 I26T probably benign Het
Olfr741 T A 14: 50,486,300 F281I probably benign Het
Olfr874 A G 9: 37,746,311 Y59C possibly damaging Het
Opa3 T C 7: 19,244,912 Y101H probably damaging Het
Pate3 T C 9: 35,648,116 N2D probably benign Het
Pcdhb21 T A 18: 37,515,718 D633E possibly damaging Het
Pgm1 C T 5: 64,127,782 P589L probably benign Het
Pigg T A 5: 108,317,391 D163E probably damaging Het
Polq A G 16: 37,060,224 T638A possibly damaging Het
Prmt3 T A 7: 49,798,346 M268K possibly damaging Het
Prmt9 T C 8: 77,565,108 C370R probably benign Het
Prss57 A T 10: 79,787,385 V76E possibly damaging Het
Pzp T C 6: 128,490,572 E1089G possibly damaging Het
Qars T A 9: 108,508,201 probably null Het
Ralgapb T C 2: 158,462,195 Y625H probably damaging Het
Rgl2 G A 17: 33,931,744 D59N probably benign Het
Robo1 T G 16: 73,004,667 W1060G probably benign Het
Scaper A T 9: 55,864,546 V362E probably benign Het
Schip1 T C 3: 68,617,684 F131S probably damaging Het
Sh2b2 A T 5: 136,227,422 V252D probably damaging Het
Slc17a6 A T 7: 51,646,209 H199L possibly damaging Het
Slc29a1 A G 17: 45,587,308 Y325H probably damaging Het
Slc29a4 G T 5: 142,714,062 W156L probably damaging Het
Slc5a3 T A 16: 92,077,756 S234T probably benign Het
Srd5a3 T G 5: 76,149,783 V20G probably damaging Het
Stac A T 9: 111,604,082 S223T possibly damaging Het
Sytl2 A T 7: 90,403,052 T766S probably benign Het
Tas2r102 A G 6: 132,762,291 D54G probably benign Het
Tbpl1 A G 10: 22,707,843 V105A probably damaging Het
Tenm3 G T 8: 48,417,179 P193Q probably benign Het
Tes G A 6: 17,104,755 V403M probably benign Het
Tgfbr2 A C 9: 116,109,880 I318S probably damaging Het
Tgfbr3 C A 5: 107,136,930 V618L probably benign Het
Tmc1 C T 19: 20,816,109 probably null Het
Tmem132a G A 19: 10,858,506 H887Y probably damaging Het
Tmem43 C A 6: 91,477,330 S33* probably null Het
Tob1 A G 11: 94,213,754 K39E probably damaging Het
Unc79 T A 12: 103,112,455 D1433E probably damaging Het
Usp25 T C 16: 77,081,554 M622T probably damaging Het
Vmn1r158 A T 7: 22,790,430 L118Q probably damaging Het
Vmn1r217 T A 13: 23,114,325 I136L probably benign Het
Vmn2r15 A T 5: 109,294,270 I99K possibly damaging Het
Vwa7 T A 17: 35,024,948 V786E probably damaging Het
Xkr5 A G 8: 18,939,132 F248S probably benign Het
Zcchc6 A T 13: 59,791,821 H705Q probably damaging Het
Zzef1 A T 11: 72,910,272 K2444M probably damaging Het
Other mutations in Dscaml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dscaml1 APN 9 45670200 nonsense probably null
IGL00497:Dscaml1 APN 9 45752238 missense probably damaging 1.00
IGL00895:Dscaml1 APN 9 45751253 missense probably damaging 0.99
IGL01011:Dscaml1 APN 9 45683672 missense possibly damaging 0.76
IGL01086:Dscaml1 APN 9 45702662 splice site probably benign
IGL01125:Dscaml1 APN 9 45749632 critical splice acceptor site probably null
IGL01132:Dscaml1 APN 9 45752328 nonsense probably null
IGL01356:Dscaml1 APN 9 45746857 missense probably benign 0.03
IGL01459:Dscaml1 APN 9 45742683 nonsense probably null
IGL01552:Dscaml1 APN 9 45447908 missense probably damaging 1.00
IGL02033:Dscaml1 APN 9 45683782 missense probably damaging 1.00
IGL02044:Dscaml1 APN 9 45746943 nonsense probably null
IGL02095:Dscaml1 APN 9 45447703 missense probably damaging 1.00
IGL02166:Dscaml1 APN 9 45683701 missense probably damaging 0.98
IGL02262:Dscaml1 APN 9 45745116 missense probably benign
IGL02262:Dscaml1 APN 9 45732080 missense probably benign 0.44
IGL02340:Dscaml1 APN 9 45670176 missense possibly damaging 0.66
IGL02604:Dscaml1 APN 9 45744328 unclassified probably benign
IGL02619:Dscaml1 APN 9 45447796 missense probably damaging 1.00
IGL02805:Dscaml1 APN 9 45447897 missense probably damaging 0.98
IGL03409:Dscaml1 APN 9 45670103 missense probably damaging 1.00
D3080:Dscaml1 UTSW 9 45684325 missense probably benign 0.44
IGL03050:Dscaml1 UTSW 9 45742999 missense probably damaging 1.00
R0149:Dscaml1 UTSW 9 45742680 nonsense probably null
R0582:Dscaml1 UTSW 9 45668264 missense possibly damaging 0.77
R0629:Dscaml1 UTSW 9 45721418 missense probably damaging 0.98
R0632:Dscaml1 UTSW 9 45732134 missense probably benign 0.06
R0815:Dscaml1 UTSW 9 45745074 missense probably benign 0.00
R1162:Dscaml1 UTSW 9 45752349 splice site probably benign
R1449:Dscaml1 UTSW 9 45742223 missense possibly damaging 0.95
R1474:Dscaml1 UTSW 9 45685221 missense probably damaging 1.00
R1481:Dscaml1 UTSW 9 45672643 missense probably benign 0.01
R1533:Dscaml1 UTSW 9 45450584 missense probably damaging 0.99
R1542:Dscaml1 UTSW 9 45749440 missense possibly damaging 0.84
R1572:Dscaml1 UTSW 9 45721333 missense probably benign 0.00
R1627:Dscaml1 UTSW 9 45753147 missense probably damaging 1.00
R1634:Dscaml1 UTSW 9 45672749 missense probably damaging 1.00
R1713:Dscaml1 UTSW 9 45752690 missense possibly damaging 0.49
R1812:Dscaml1 UTSW 9 45751286 critical splice donor site probably null
R1834:Dscaml1 UTSW 9 45683632 missense probably benign 0.00
R1907:Dscaml1 UTSW 9 45740480 missense probably damaging 1.00
R1953:Dscaml1 UTSW 9 45670224 missense probably benign 0.01
R2056:Dscaml1 UTSW 9 45750132 missense probably damaging 0.99
R2193:Dscaml1 UTSW 9 45685234 missense probably benign 0.21
R2497:Dscaml1 UTSW 9 45745078 missense probably benign 0.00
R3768:Dscaml1 UTSW 9 45732137 missense possibly damaging 0.94
R3891:Dscaml1 UTSW 9 45717484 missense possibly damaging 0.84
R4110:Dscaml1 UTSW 9 45732068 missense probably benign 0.07
R4706:Dscaml1 UTSW 9 45450580 missense probably damaging 1.00
R4716:Dscaml1 UTSW 9 45450592 missense probably damaging 1.00
R4719:Dscaml1 UTSW 9 45672695 missense probably benign 0.13
R4770:Dscaml1 UTSW 9 45670106 missense probably damaging 1.00
R4924:Dscaml1 UTSW 9 45745189 missense probably damaging 1.00
R5167:Dscaml1 UTSW 9 45717432 missense probably damaging 1.00
R5346:Dscaml1 UTSW 9 45450559 missense possibly damaging 0.63
R5737:Dscaml1 UTSW 9 45745185 missense probably damaging 0.99
R5977:Dscaml1 UTSW 9 45721298 missense probably benign 0.19
R6073:Dscaml1 UTSW 9 45450583 missense probably benign 0.22
R6276:Dscaml1 UTSW 9 45668160 missense possibly damaging 0.62
R6415:Dscaml1 UTSW 9 45683677 nonsense probably null
R6527:Dscaml1 UTSW 9 45712184 nonsense probably null
R6582:Dscaml1 UTSW 9 45752806 missense probably benign 0.00
R6655:Dscaml1 UTSW 9 45746937 missense probably benign 0.00
R6772:Dscaml1 UTSW 9 45710311 missense probably damaging 1.00
R6799:Dscaml1 UTSW 9 45450583 missense probably benign 0.22
R6892:Dscaml1 UTSW 9 45683830 missense probably damaging 0.99
R6918:Dscaml1 UTSW 9 45430507 missense probably benign
R6967:Dscaml1 UTSW 9 45674523 missense probably damaging 0.97
X0058:Dscaml1 UTSW 9 45752128 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGAGAGCCGGGAAGACTAACAC -3'
(R):5'- TGTCTTTAAGAAGCCATCCAGCACC -3'

Sequencing Primer
(F):5'- TGGAGAGCTACACTCTAGCC -3'
(R):5'- CCATCCAGCACCAACCTC -3'
Posted On2014-05-23