Incidental Mutation 'R1778:Ahctf1'
ID197190
Institutional Source Beutler Lab
Gene Symbol Ahctf1
Ensembl Gene ENSMUSG00000026491
Gene NameAT hook containing transcription factor 1
Synonyms6230412P20Rik, Elys
MMRRC Submission 039809-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1778 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location179744894-179803680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 179753015 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1874 (L1874Q)
Ref Sequence ENSEMBL: ENSMUSP00000027768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027768] [ENSMUST00000125816]
PDB Structure
Nucleoporin ELYS (aa1-494), Mus musculus [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027768
AA Change: L1874Q

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027768
Gene: ENSMUSG00000026491
AA Change: L1874Q

DomainStartEndE-ValueType
Pfam:ELYS-bb 1 489 1.6e-307 PFAM
Pfam:ELYS 722 955 2.5e-58 PFAM
low complexity region 1138 1155 N/A INTRINSIC
low complexity region 1180 1192 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1597 1610 N/A INTRINSIC
low complexity region 1684 1694 N/A INTRINSIC
low complexity region 1834 1841 N/A INTRINSIC
low complexity region 1918 1935 N/A INTRINSIC
AT_hook 1955 1967 3.35e-1 SMART
low complexity region 2060 2066 N/A INTRINSIC
low complexity region 2073 2084 N/A INTRINSIC
low complexity region 2096 2108 N/A INTRINSIC
Blast:KISc 2164 2217 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000125816
Predicted Effect probably benign
Transcript: ENSMUST00000140489
SMART Domains Protein: ENSMUSP00000115253
Gene: ENSMUSG00000026491

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151734
Meta Mutation Damage Score 0.1148 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency 98% (107/109)
MGI Phenotype PHENOTYPE: Homozygous null mice die between E3.5 and E5.5. The inner cell mass cells exhibit impaired proliferation and apoptosis when grown in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G T 10: 77,982,944 A150S probably benign Het
4930432E11Rik T C 7: 29,560,706 noncoding transcript Het
4930568D16Rik A G 2: 35,354,983 M119T probably damaging Het
Aadacl2 A G 3: 60,017,450 probably null Het
Abca9 C T 11: 110,130,716 W1056* probably null Het
Adam20 A C 8: 40,796,661 T603P possibly damaging Het
Adgrl1 T C 8: 83,930,037 L323P probably damaging Het
Afap1l2 C T 19: 56,916,206 E628K possibly damaging Het
Ak8 A G 2: 28,712,321 E89G probably benign Het
Aldh16a1 G A 7: 45,147,308 R256C probably damaging Het
Anxa5 G A 3: 36,465,331 T3M probably damaging Het
Arhgef16 T C 4: 154,287,986 K210E probably benign Het
Armc4 A T 18: 7,127,388 C942S probably damaging Het
Baz2b T C 2: 60,006,136 T18A unknown Het
BC037034 T C 5: 138,262,477 probably null Het
Bub1 A C 2: 127,803,122 I960M possibly damaging Het
Cbln2 G T 18: 86,713,147 D27Y probably benign Het
Ces2h C A 8: 105,014,607 P77Q possibly damaging Het
Chga T A 12: 102,561,700 M150K probably benign Het
Chmp3 A G 6: 71,577,807 E162G probably benign Het
Clip3 A G 7: 30,297,436 N161S probably damaging Het
Col12a1 T A 9: 79,604,585 probably benign Het
Cuedc2 C T 19: 46,331,640 G105D probably benign Het
Cyp2j7 A C 4: 96,199,390 F428V probably damaging Het
Ddx60 A G 8: 61,974,176 I762V possibly damaging Het
Def6 G A 17: 28,220,186 R257Q probably benign Het
Dkkl1 A T 7: 45,211,395 probably null Het
Dnah3 A G 7: 120,078,402 L433P probably damaging Het
Eif2s3y C T Y: 1,011,287 R33C probably benign Het
Elavl2 T A 4: 91,253,478 Y269F probably damaging Het
Esco2 A G 14: 65,831,262 S200P possibly damaging Het
Fam213b A T 4: 154,897,357 V151D probably damaging Het
Fcrl1 T A 3: 87,385,319 probably benign Het
Fhod1 C A 8: 105,329,677 D1135Y probably damaging Het
Fnbp1l T C 3: 122,590,147 N41D possibly damaging Het
Folh1 A T 7: 86,761,699 probably null Het
Fpr-rs7 T C 17: 20,114,015 D71G probably damaging Het
Gm10271 A G 10: 116,961,939 probably benign Het
Gm4841 A T 18: 60,270,948 Y24* probably null Het
Gm9825 A T 6: 7,983,124 noncoding transcript Het
Greb1 G A 12: 16,690,894 R1396C probably benign Het
Hectd1 C T 12: 51,753,807 C2076Y probably damaging Het
Hnrnpu A G 1: 178,325,241 probably benign Het
Ice2 T C 9: 69,415,648 I475T probably benign Het
Ifit1bl1 T A 19: 34,594,193 Q288L probably damaging Het
Ik T C 18: 36,756,818 probably benign Het
Kidins220 C T 12: 25,013,446 probably benign Het
Kmt2c T C 5: 25,372,974 D768G probably benign Het
Kmt2e A G 5: 23,492,364 T87A probably damaging Het
Lama5 G A 2: 180,195,481 probably benign Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Lrig2 A G 3: 104,467,366 probably benign Het
Lrig3 A G 10: 126,010,075 D791G probably damaging Het
Lrrc2 G A 9: 110,980,840 V315M probably benign Het
Lrrc4b A G 7: 44,462,399 D565G probably benign Het
Mpped1 C T 15: 83,791,990 probably benign Het
Msrb2 T A 2: 19,383,303 D87E probably benign Het
Muc20 T C 16: 32,794,141 T289A possibly damaging Het
Myo15 C A 11: 60,478,412 P666Q possibly damaging Het
Nfat5 C T 8: 107,361,789 P579L probably damaging Het
Nipbl A C 15: 8,319,488 M1920R probably damaging Het
Nuak1 T C 10: 84,374,874 probably null Het
Nup210l A G 3: 90,189,486 E1334G probably damaging Het
Olfr12 G A 1: 92,620,620 G238E possibly damaging Het
Olfr1410 A T 1: 92,608,109 N91Y possibly damaging Het
Olfr262 T A 19: 12,241,455 I69F probably benign Het
Olfr675 A T 7: 105,024,163 N272K probably benign Het
Olfr804 T C 10: 129,705,705 Y276H probably benign Het
P4ha3 A T 7: 100,300,691 probably null Het
Pbld2 C T 10: 63,054,371 A186V probably benign Het
Pcdh18 A T 3: 49,755,634 Y411N probably benign Het
Pgf A G 12: 85,171,767 S70P probably benign Het
Phrf1 T A 7: 141,232,456 D44E probably benign Het
Pla2g4a A G 1: 149,902,445 probably benign Het
Plce1 A G 19: 38,780,790 probably benign Het
Plxna2 A G 1: 194,810,970 N1851S probably benign Het
Prl7a2 G A 13: 27,659,271 T183I probably damaging Het
Ptger4 A T 15: 5,235,095 L335H probably damaging Het
Ptgr1 A G 4: 58,984,865 probably benign Het
Rdh7 A G 10: 127,884,721 S261P probably benign Het
Reg3a A G 6: 78,383,286 T150A probably benign Het
Rnf111 A G 9: 70,476,112 S180P probably benign Het
Rnf17 A G 14: 56,522,399 M1554V probably damaging Het
Rnf215 T A 11: 4,135,873 Y117* probably null Het
Rogdi T C 16: 5,010,505 T165A probably benign Het
Rpe65 A G 3: 159,622,848 Y431C probably damaging Het
Scube1 A G 15: 83,610,204 F844S probably damaging Het
Sdr16c6 T A 4: 4,058,814 E257D probably benign Het
Sim1 C A 10: 50,981,553 C466* probably null Het
Spi1 T A 2: 91,099,522 H46Q probably damaging Het
Sumf2 C A 5: 129,845,068 probably benign Het
Tbcb A G 7: 30,231,612 Y28H probably benign Het
Tecta C T 9: 42,343,631 C1752Y probably damaging Het
Tep1 T C 14: 50,829,622 probably benign Het
Tmem245 A T 4: 56,903,968 W591R probably damaging Het
Tnxb A G 17: 34,683,574 I1134V probably benign Het
Trim13 G T 14: 61,605,619 A362S probably benign Het
Trim47 T A 11: 116,109,820 D134V probably damaging Het
Ttc26 T A 6: 38,409,476 D377E possibly damaging Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vnn1 G T 10: 23,899,517 A222S possibly damaging Het
Wdr17 A G 8: 54,690,214 W110R probably damaging Het
Wwp1 G T 4: 19,627,892 Y700* probably null Het
Zbtb21 T C 16: 97,950,585 S661G probably benign Het
Zfp955b A G 17: 33,302,814 K419R probably benign Het
Other mutations in Ahctf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Ahctf1 APN 1 179769131 missense probably damaging 1.00
IGL01714:Ahctf1 APN 1 179795877 missense probably damaging 0.99
IGL01787:Ahctf1 APN 1 179753322 missense probably benign
IGL01997:Ahctf1 APN 1 179755462 missense probably damaging 0.99
IGL02035:Ahctf1 APN 1 179766014 missense probably benign 0.00
IGL02158:Ahctf1 APN 1 179779652 missense possibly damaging 0.64
IGL02182:Ahctf1 APN 1 179753078 missense probably benign 0.00
IGL02298:Ahctf1 APN 1 179752479 missense probably benign 0.00
IGL02325:Ahctf1 APN 1 179776015 missense probably benign 0.14
IGL02619:Ahctf1 APN 1 179792451 missense possibly damaging 0.90
IGL02858:Ahctf1 APN 1 179769034 missense probably damaging 0.96
IGL02893:Ahctf1 APN 1 179776011 nonsense probably null
IGL02895:Ahctf1 APN 1 179793811 missense probably damaging 1.00
IGL03180:Ahctf1 APN 1 179775330 critical splice donor site probably null
IGL03220:Ahctf1 APN 1 179788202 missense probably benign 0.01
cerebro UTSW 1 179769414 missense probably damaging 0.99
R0003:Ahctf1 UTSW 1 179763473 missense probably benign 0.04
R0024:Ahctf1 UTSW 1 179752436 missense probably damaging 0.98
R0030:Ahctf1 UTSW 1 179752436 missense probably damaging 0.98
R0432:Ahctf1 UTSW 1 179784161 missense probably damaging 0.98
R0481:Ahctf1 UTSW 1 179760271 missense probably benign 0.00
R0600:Ahctf1 UTSW 1 179763468 critical splice donor site probably null
R0613:Ahctf1 UTSW 1 179769414 missense probably damaging 0.99
R0814:Ahctf1 UTSW 1 179762908 missense probably benign 0.26
R1055:Ahctf1 UTSW 1 179763486 missense possibly damaging 0.46
R1473:Ahctf1 UTSW 1 179776108 missense probably benign 0.30
R1473:Ahctf1 UTSW 1 179799279 missense probably damaging 0.99
R1689:Ahctf1 UTSW 1 179768383 missense probably damaging 0.96
R1878:Ahctf1 UTSW 1 179775509 missense possibly damaging 0.96
R1925:Ahctf1 UTSW 1 179770653 missense probably damaging 0.98
R2118:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2122:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2124:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2373:Ahctf1 UTSW 1 179795796 missense probably damaging 1.00
R2509:Ahctf1 UTSW 1 179770693 missense possibly damaging 0.51
R2697:Ahctf1 UTSW 1 179752532 missense probably damaging 0.99
R3035:Ahctf1 UTSW 1 179753870 missense probably damaging 1.00
R3155:Ahctf1 UTSW 1 179755583 missense probably damaging 0.98
R3899:Ahctf1 UTSW 1 179777780 missense possibly damaging 0.95
R4036:Ahctf1 UTSW 1 179762616 missense possibly damaging 0.61
R4681:Ahctf1 UTSW 1 179752796 missense probably benign 0.27
R4695:Ahctf1 UTSW 1 179753054 missense possibly damaging 0.78
R4735:Ahctf1 UTSW 1 179753399 missense probably benign 0.00
R4857:Ahctf1 UTSW 1 179799357 unclassified probably benign
R4898:Ahctf1 UTSW 1 179755512 missense probably benign 0.02
R4905:Ahctf1 UTSW 1 179748627 missense probably damaging 1.00
R5011:Ahctf1 UTSW 1 179784110 missense possibly damaging 0.92
R5013:Ahctf1 UTSW 1 179784110 missense possibly damaging 0.92
R5053:Ahctf1 UTSW 1 179786784 missense possibly damaging 0.82
R5207:Ahctf1 UTSW 1 179793594 intron probably benign
R5319:Ahctf1 UTSW 1 179769050 missense probably damaging 1.00
R5343:Ahctf1 UTSW 1 179770634 nonsense probably null
R5546:Ahctf1 UTSW 1 179754068 missense probably benign 0.01
R5718:Ahctf1 UTSW 1 179769339 missense possibly damaging 0.54
R5862:Ahctf1 UTSW 1 179788330 missense probably damaging 1.00
R5958:Ahctf1 UTSW 1 179746542 unclassified probably benign
R6010:Ahctf1 UTSW 1 179795813 missense possibly damaging 0.80
R6081:Ahctf1 UTSW 1 179781672 missense probably benign 0.07
R6093:Ahctf1 UTSW 1 179762952 missense probably benign 0.01
R6207:Ahctf1 UTSW 1 179777390 intron probably null
R6268:Ahctf1 UTSW 1 179763483 missense probably benign 0.08
R6656:Ahctf1 UTSW 1 179753513 missense probably benign 0.05
R6668:Ahctf1 UTSW 1 179752407 missense probably benign 0.04
R6788:Ahctf1 UTSW 1 179752634 missense probably benign 0.00
R6860:Ahctf1 UTSW 1 179753288 missense probably benign 0.04
X0067:Ahctf1 UTSW 1 179777704 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCTCTTCTGTCACACTTGACACAC -3'
(R):5'- AAGGACGTTAGCCAAGGCACAC -3'

Sequencing Primer
(F):5'- TGTCACACTTGACACACTAACTTC -3'
(R):5'- AGGCACACTGCCAAGTTCTG -3'
Posted On2014-05-23