Incidental Mutation 'R1778:Folh1'
ID197235
Institutional Source Beutler Lab
Gene Symbol Folh1
Ensembl Gene ENSMUSG00000001773
Gene Namefolate hydrolase 1
Synonymsprostate-specific membrane antigen, glutamate carboxypeptidase II, mopsm, GCP2
MMRRC Submission 039809-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1778 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86718977-86775943 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 86761699 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001824] [ENSMUST00000107271]
Predicted Effect probably null
Transcript: ENSMUST00000001824
SMART Domains Protein: ENSMUSP00000001824
Gene: ENSMUSG00000001773

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:PA 171 264 2.5e-16 PFAM
Pfam:Peptidase_M28 359 561 1.2e-18 PFAM
Pfam:TFR_dimer 629 749 1.6e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107271
SMART Domains Protein: ENSMUSP00000102892
Gene: ENSMUSG00000001773

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:PA 167 265 7e-18 PFAM
Pfam:Peptidase_M28 339 475 2.1e-15 PFAM
Pfam:TFR_dimer 595 718 1.1e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209082
Meta Mutation Damage Score 0.536 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency 98% (107/109)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in protection from peripheral neuropathy and ischemic brain injury. Homozygotes for a null allele show increased food intake, anxiety-like behavior, smaller sciatic nerve axons, and impaired angiogenesis. Homozygotes for a different null allele show less neuron degeneration and astrocyte damage after traumatic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G T 10: 77,982,944 A150S probably benign Het
4930432E11Rik T C 7: 29,560,706 noncoding transcript Het
4930568D16Rik A G 2: 35,354,983 M119T probably damaging Het
Aadacl2 A G 3: 60,017,450 probably null Het
Abca9 C T 11: 110,130,716 W1056* probably null Het
Adam20 A C 8: 40,796,661 T603P possibly damaging Het
Adgrl1 T C 8: 83,930,037 L323P probably damaging Het
Afap1l2 C T 19: 56,916,206 E628K possibly damaging Het
Ahctf1 A T 1: 179,753,015 L1874Q possibly damaging Het
Ak8 A G 2: 28,712,321 E89G probably benign Het
Aldh16a1 G A 7: 45,147,308 R256C probably damaging Het
Anxa5 G A 3: 36,465,331 T3M probably damaging Het
Arhgef16 T C 4: 154,287,986 K210E probably benign Het
Armc4 A T 18: 7,127,388 C942S probably damaging Het
Baz2b T C 2: 60,006,136 T18A unknown Het
BC037034 T C 5: 138,262,477 probably null Het
Bub1 A C 2: 127,803,122 I960M possibly damaging Het
Cbln2 G T 18: 86,713,147 D27Y probably benign Het
Ces2h C A 8: 105,014,607 P77Q possibly damaging Het
Chga T A 12: 102,561,700 M150K probably benign Het
Chmp3 A G 6: 71,577,807 E162G probably benign Het
Clip3 A G 7: 30,297,436 N161S probably damaging Het
Col12a1 T A 9: 79,604,585 probably benign Het
Cuedc2 C T 19: 46,331,640 G105D probably benign Het
Cyp2j7 A C 4: 96,199,390 F428V probably damaging Het
Ddx60 A G 8: 61,974,176 I762V possibly damaging Het
Def6 G A 17: 28,220,186 R257Q probably benign Het
Dkkl1 A T 7: 45,211,395 probably null Het
Dnah3 A G 7: 120,078,402 L433P probably damaging Het
Eif2s3y C T Y: 1,011,287 R33C probably benign Het
Elavl2 T A 4: 91,253,478 Y269F probably damaging Het
Esco2 A G 14: 65,831,262 S200P possibly damaging Het
Fam213b A T 4: 154,897,357 V151D probably damaging Het
Fcrl1 T A 3: 87,385,319 probably benign Het
Fhod1 C A 8: 105,329,677 D1135Y probably damaging Het
Fnbp1l T C 3: 122,590,147 N41D possibly damaging Het
Fpr-rs7 T C 17: 20,114,015 D71G probably damaging Het
Gm10271 A G 10: 116,961,939 probably benign Het
Gm4841 A T 18: 60,270,948 Y24* probably null Het
Gm9825 A T 6: 7,983,124 noncoding transcript Het
Greb1 G A 12: 16,690,894 R1396C probably benign Het
Hectd1 C T 12: 51,753,807 C2076Y probably damaging Het
Hnrnpu A G 1: 178,325,241 probably benign Het
Ice2 T C 9: 69,415,648 I475T probably benign Het
Ifit1bl1 T A 19: 34,594,193 Q288L probably damaging Het
Ik T C 18: 36,756,818 probably benign Het
Kidins220 C T 12: 25,013,446 probably benign Het
Kmt2c T C 5: 25,372,974 D768G probably benign Het
Kmt2e A G 5: 23,492,364 T87A probably damaging Het
Lama5 G A 2: 180,195,481 probably benign Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Lrig2 A G 3: 104,467,366 probably benign Het
Lrig3 A G 10: 126,010,075 D791G probably damaging Het
Lrrc2 G A 9: 110,980,840 V315M probably benign Het
Lrrc4b A G 7: 44,462,399 D565G probably benign Het
Mpped1 C T 15: 83,791,990 probably benign Het
Msrb2 T A 2: 19,383,303 D87E probably benign Het
Muc20 T C 16: 32,794,141 T289A possibly damaging Het
Myo15 C A 11: 60,478,412 P666Q possibly damaging Het
Nfat5 C T 8: 107,361,789 P579L probably damaging Het
Nipbl A C 15: 8,319,488 M1920R probably damaging Het
Nuak1 T C 10: 84,374,874 probably null Het
Nup210l A G 3: 90,189,486 E1334G probably damaging Het
Olfr12 G A 1: 92,620,620 G238E possibly damaging Het
Olfr1410 A T 1: 92,608,109 N91Y possibly damaging Het
Olfr262 T A 19: 12,241,455 I69F probably benign Het
Olfr675 A T 7: 105,024,163 N272K probably benign Het
Olfr804 T C 10: 129,705,705 Y276H probably benign Het
P4ha3 A T 7: 100,300,691 probably null Het
Pbld2 C T 10: 63,054,371 A186V probably benign Het
Pcdh18 A T 3: 49,755,634 Y411N probably benign Het
Pgf A G 12: 85,171,767 S70P probably benign Het
Phrf1 T A 7: 141,232,456 D44E probably benign Het
Pla2g4a A G 1: 149,902,445 probably benign Het
Plce1 A G 19: 38,780,790 probably benign Het
Plxna2 A G 1: 194,810,970 N1851S probably benign Het
Prl7a2 G A 13: 27,659,271 T183I probably damaging Het
Ptger4 A T 15: 5,235,095 L335H probably damaging Het
Ptgr1 A G 4: 58,984,865 probably benign Het
Rdh7 A G 10: 127,884,721 S261P probably benign Het
Reg3a A G 6: 78,383,286 T150A probably benign Het
Rnf111 A G 9: 70,476,112 S180P probably benign Het
Rnf17 A G 14: 56,522,399 M1554V probably damaging Het
Rnf215 T A 11: 4,135,873 Y117* probably null Het
Rogdi T C 16: 5,010,505 T165A probably benign Het
Rpe65 A G 3: 159,622,848 Y431C probably damaging Het
Scube1 A G 15: 83,610,204 F844S probably damaging Het
Sdr16c6 T A 4: 4,058,814 E257D probably benign Het
Sim1 C A 10: 50,981,553 C466* probably null Het
Spi1 T A 2: 91,099,522 H46Q probably damaging Het
Sumf2 C A 5: 129,845,068 probably benign Het
Tbcb A G 7: 30,231,612 Y28H probably benign Het
Tecta C T 9: 42,343,631 C1752Y probably damaging Het
Tep1 T C 14: 50,829,622 probably benign Het
Tmem245 A T 4: 56,903,968 W591R probably damaging Het
Tnxb A G 17: 34,683,574 I1134V probably benign Het
Trim13 G T 14: 61,605,619 A362S probably benign Het
Trim47 T A 11: 116,109,820 D134V probably damaging Het
Ttc26 T A 6: 38,409,476 D377E possibly damaging Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vnn1 G T 10: 23,899,517 A222S possibly damaging Het
Wdr17 A G 8: 54,690,214 W110R probably damaging Het
Wwp1 G T 4: 19,627,892 Y700* probably null Het
Zbtb21 T C 16: 97,950,585 S661G probably benign Het
Zfp955b A G 17: 33,302,814 K419R probably benign Het
Other mutations in Folh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Folh1 APN 7 86734143 missense probably damaging 1.00
IGL00531:Folh1 APN 7 86719769 missense possibly damaging 0.82
IGL00772:Folh1 APN 7 86731784 missense probably damaging 1.00
IGL01339:Folh1 APN 7 86726098 missense probably damaging 1.00
IGL01373:Folh1 APN 7 86746142 missense probably benign 0.39
IGL01645:Folh1 APN 7 86742227 missense probably damaging 1.00
IGL01736:Folh1 APN 7 86742236 missense possibly damaging 0.96
IGL02104:Folh1 APN 7 86744430 missense possibly damaging 0.93
IGL02124:Folh1 APN 7 86725418 missense probably damaging 0.99
IGL02338:Folh1 APN 7 86736515 splice site probably benign
IGL02440:Folh1 APN 7 86734104 missense probably benign 0.09
IGL02689:Folh1 APN 7 86763045 splice site probably null
IGL02976:Folh1 APN 7 86762918 missense probably benign
IGL03022:Folh1 APN 7 86746171 missense possibly damaging 0.76
R0090:Folh1 UTSW 7 86725868 splice site probably benign
R0285:Folh1 UTSW 7 86742165 splice site probably benign
R0482:Folh1 UTSW 7 86746101 splice site probably benign
R0492:Folh1 UTSW 7 86746192 missense probably damaging 1.00
R1079:Folh1 UTSW 7 86771881 missense probably damaging 1.00
R1148:Folh1 UTSW 7 86761730 missense probably damaging 1.00
R1148:Folh1 UTSW 7 86761730 missense probably damaging 1.00
R1493:Folh1 UTSW 7 86761730 missense probably damaging 1.00
R1865:Folh1 UTSW 7 86725906 missense possibly damaging 0.65
R1878:Folh1 UTSW 7 86771742 missense probably benign
R1906:Folh1 UTSW 7 86742166 splice site probably null
R1912:Folh1 UTSW 7 86762967 missense possibly damaging 0.95
R2263:Folh1 UTSW 7 86719765 missense probably benign
R3001:Folh1 UTSW 7 86723311 missense probably damaging 1.00
R3002:Folh1 UTSW 7 86723311 missense probably damaging 1.00
R3883:Folh1 UTSW 7 86775656 missense possibly damaging 0.48
R4061:Folh1 UTSW 7 86756962 missense possibly damaging 0.49
R4277:Folh1 UTSW 7 86762915 critical splice donor site probably null
R4507:Folh1 UTSW 7 86757008 missense probably benign
R4627:Folh1 UTSW 7 86773252 missense probably benign 0.00
R4652:Folh1 UTSW 7 86744425 nonsense probably null
R4653:Folh1 UTSW 7 86744425 nonsense probably null
R4745:Folh1 UTSW 7 86723274 critical splice donor site probably null
R5571:Folh1 UTSW 7 86734120 missense probably damaging 1.00
R6000:Folh1 UTSW 7 86725934 missense probably benign 0.01
R6307:Folh1 UTSW 7 86723309 missense probably damaging 1.00
R6474:Folh1 UTSW 7 86775756 missense probably damaging 0.99
Z1088:Folh1 UTSW 7 86725954 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTGGTATTCACACATGCTGCTGC -3'
(R):5'- TCAACATTTGCTGCTCTGCAAAACC -3'

Sequencing Primer
(F):5'- GTCAGAGTTCCAAAGTTGCAGTC -3'
(R):5'- gagactctgagacaggaagataac -3'
Posted On2014-05-23