Incidental Mutation 'R1778:Ptger4'
ID197275
Institutional Source Beutler Lab
Gene Symbol Ptger4
Ensembl Gene ENSMUSG00000039942
Gene Nameprostaglandin E receptor 4 (subtype EP4)
SynonymsEP4, Ptgerep4
MMRRC Submission 039809-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R1778 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location5206661-5244187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5235095 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 335 (L335H)
Ref Sequence ENSEMBL: ENSMUSP00000112858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047379] [ENSMUST00000120563]
Predicted Effect probably damaging
Transcript: ENSMUST00000047379
AA Change: L360H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048736
Gene: ENSMUSG00000039942
AA Change: L360H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 50 258 1.3e-7 PFAM
Pfam:7tm_1 59 357 1.3e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120563
AA Change: L335H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112858
Gene: ENSMUSG00000039942
AA Change: L335H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 25 233 1.9e-7 PFAM
Pfam:7tm_1 34 332 8.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133966
Meta Mutation Damage Score 0.0288 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). This receptor can activate T-cell factor signaling. It has been shown to mediate PGE2 induced expression of early growth response 1 (EGR1), regulate the level and stability of cyclooxygenase-2 mRNA, and lead to the phosphorylation of glycogen synthase kinase-3. Knockout studies in mice suggest that this receptor may be involved in the neonatal adaptation of circulatory system, osteoporosis, as well as initiation of skin immune responses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygous targeted null mutants die shortly after birth due to failed closure of the ductus arteriosis. Survivors show decreased migration of Langerhans cells to lymph nodes, contact hypersensitivity and decreased incidence of induced arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G T 10: 77,982,944 A150S probably benign Het
4930432E11Rik T C 7: 29,560,706 noncoding transcript Het
4930568D16Rik A G 2: 35,354,983 M119T probably damaging Het
Aadacl2 A G 3: 60,017,450 probably null Het
Abca9 C T 11: 110,130,716 W1056* probably null Het
Adam20 A C 8: 40,796,661 T603P possibly damaging Het
Adgrl1 T C 8: 83,930,037 L323P probably damaging Het
Afap1l2 C T 19: 56,916,206 E628K possibly damaging Het
Ahctf1 A T 1: 179,753,015 L1874Q possibly damaging Het
Ak8 A G 2: 28,712,321 E89G probably benign Het
Aldh16a1 G A 7: 45,147,308 R256C probably damaging Het
Anxa5 G A 3: 36,465,331 T3M probably damaging Het
Arhgef16 T C 4: 154,287,986 K210E probably benign Het
Armc4 A T 18: 7,127,388 C942S probably damaging Het
Baz2b T C 2: 60,006,136 T18A unknown Het
BC037034 T C 5: 138,262,477 probably null Het
Bub1 A C 2: 127,803,122 I960M possibly damaging Het
Cbln2 G T 18: 86,713,147 D27Y probably benign Het
Ces2h C A 8: 105,014,607 P77Q possibly damaging Het
Chga T A 12: 102,561,700 M150K probably benign Het
Chmp3 A G 6: 71,577,807 E162G probably benign Het
Clip3 A G 7: 30,297,436 N161S probably damaging Het
Col12a1 T A 9: 79,604,585 probably benign Het
Cuedc2 C T 19: 46,331,640 G105D probably benign Het
Cyp2j7 A C 4: 96,199,390 F428V probably damaging Het
Ddx60 A G 8: 61,974,176 I762V possibly damaging Het
Def6 G A 17: 28,220,186 R257Q probably benign Het
Dkkl1 A T 7: 45,211,395 probably null Het
Dnah3 A G 7: 120,078,402 L433P probably damaging Het
Eif2s3y C T Y: 1,011,287 R33C probably benign Het
Elavl2 T A 4: 91,253,478 Y269F probably damaging Het
Esco2 A G 14: 65,831,262 S200P possibly damaging Het
Fam213b A T 4: 154,897,357 V151D probably damaging Het
Fcrl1 T A 3: 87,385,319 probably benign Het
Fhod1 C A 8: 105,329,677 D1135Y probably damaging Het
Fnbp1l T C 3: 122,590,147 N41D possibly damaging Het
Folh1 A T 7: 86,761,699 probably null Het
Fpr-rs7 T C 17: 20,114,015 D71G probably damaging Het
Gm10271 A G 10: 116,961,939 probably benign Het
Gm4841 A T 18: 60,270,948 Y24* probably null Het
Gm9825 A T 6: 7,983,124 noncoding transcript Het
Greb1 G A 12: 16,690,894 R1396C probably benign Het
Hectd1 C T 12: 51,753,807 C2076Y probably damaging Het
Hnrnpu A G 1: 178,325,241 probably benign Het
Ice2 T C 9: 69,415,648 I475T probably benign Het
Ifit1bl1 T A 19: 34,594,193 Q288L probably damaging Het
Ik T C 18: 36,756,818 probably benign Het
Kidins220 C T 12: 25,013,446 probably benign Het
Kmt2c T C 5: 25,372,974 D768G probably benign Het
Kmt2e A G 5: 23,492,364 T87A probably damaging Het
Lama5 G A 2: 180,195,481 probably benign Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Lrig2 A G 3: 104,467,366 probably benign Het
Lrig3 A G 10: 126,010,075 D791G probably damaging Het
Lrrc2 G A 9: 110,980,840 V315M probably benign Het
Lrrc4b A G 7: 44,462,399 D565G probably benign Het
Mpped1 C T 15: 83,791,990 probably benign Het
Msrb2 T A 2: 19,383,303 D87E probably benign Het
Muc20 T C 16: 32,794,141 T289A possibly damaging Het
Myo15 C A 11: 60,478,412 P666Q possibly damaging Het
Nfat5 C T 8: 107,361,789 P579L probably damaging Het
Nipbl A C 15: 8,319,488 M1920R probably damaging Het
Nuak1 T C 10: 84,374,874 probably null Het
Nup210l A G 3: 90,189,486 E1334G probably damaging Het
Olfr12 G A 1: 92,620,620 G238E possibly damaging Het
Olfr1410 A T 1: 92,608,109 N91Y possibly damaging Het
Olfr262 T A 19: 12,241,455 I69F probably benign Het
Olfr675 A T 7: 105,024,163 N272K probably benign Het
Olfr804 T C 10: 129,705,705 Y276H probably benign Het
P4ha3 A T 7: 100,300,691 probably null Het
Pbld2 C T 10: 63,054,371 A186V probably benign Het
Pcdh18 A T 3: 49,755,634 Y411N probably benign Het
Pgf A G 12: 85,171,767 S70P probably benign Het
Phrf1 T A 7: 141,232,456 D44E probably benign Het
Pla2g4a A G 1: 149,902,445 probably benign Het
Plce1 A G 19: 38,780,790 probably benign Het
Plxna2 A G 1: 194,810,970 N1851S probably benign Het
Prl7a2 G A 13: 27,659,271 T183I probably damaging Het
Ptgr1 A G 4: 58,984,865 probably benign Het
Rdh7 A G 10: 127,884,721 S261P probably benign Het
Reg3a A G 6: 78,383,286 T150A probably benign Het
Rnf111 A G 9: 70,476,112 S180P probably benign Het
Rnf17 A G 14: 56,522,399 M1554V probably damaging Het
Rnf215 T A 11: 4,135,873 Y117* probably null Het
Rogdi T C 16: 5,010,505 T165A probably benign Het
Rpe65 A G 3: 159,622,848 Y431C probably damaging Het
Scube1 A G 15: 83,610,204 F844S probably damaging Het
Sdr16c6 T A 4: 4,058,814 E257D probably benign Het
Sim1 C A 10: 50,981,553 C466* probably null Het
Spi1 T A 2: 91,099,522 H46Q probably damaging Het
Sumf2 C A 5: 129,845,068 probably benign Het
Tbcb A G 7: 30,231,612 Y28H probably benign Het
Tecta C T 9: 42,343,631 C1752Y probably damaging Het
Tep1 T C 14: 50,829,622 probably benign Het
Tmem245 A T 4: 56,903,968 W591R probably damaging Het
Tnxb A G 17: 34,683,574 I1134V probably benign Het
Trim13 G T 14: 61,605,619 A362S probably benign Het
Trim47 T A 11: 116,109,820 D134V probably damaging Het
Ttc26 T A 6: 38,409,476 D377E possibly damaging Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vnn1 G T 10: 23,899,517 A222S possibly damaging Het
Wdr17 A G 8: 54,690,214 W110R probably damaging Het
Wwp1 G T 4: 19,627,892 Y700* probably null Het
Zbtb21 T C 16: 97,950,585 S661G probably benign Het
Zfp955b A G 17: 33,302,814 K419R probably benign Het
Other mutations in Ptger4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Ptger4 APN 15 5243133 missense probably benign 0.00
IGL00848:Ptger4 APN 15 5235108 missense probably benign 0.16
IGL01309:Ptger4 APN 15 5242758 missense probably damaging 1.00
IGL02083:Ptger4 APN 15 5243174 missense probably benign 0.00
IGL03245:Ptger4 APN 15 5235107 missense probably damaging 1.00
R0369:Ptger4 UTSW 15 5243010 missense probably benign 0.06
R0427:Ptger4 UTSW 15 5242901 missense probably benign 0.25
R1399:Ptger4 UTSW 15 5234931 missense possibly damaging 0.81
R1801:Ptger4 UTSW 15 5242800 missense possibly damaging 0.95
R2089:Ptger4 UTSW 15 5242845 missense possibly damaging 0.80
R2091:Ptger4 UTSW 15 5242845 missense possibly damaging 0.80
R2091:Ptger4 UTSW 15 5242845 missense possibly damaging 0.80
R2484:Ptger4 UTSW 15 5235173 missense probably benign 0.06
R2873:Ptger4 UTSW 15 5234805 missense probably benign 0.02
R4515:Ptger4 UTSW 15 5242379 missense probably damaging 1.00
R4572:Ptger4 UTSW 15 5243133 missense probably benign 0.00
R4655:Ptger4 UTSW 15 5243064 missense probably benign 0.06
R4860:Ptger4 UTSW 15 5242606 missense probably benign 0.02
R4860:Ptger4 UTSW 15 5242606 missense probably benign 0.02
R6429:Ptger4 UTSW 15 5242997 missense possibly damaging 0.76
R6960:Ptger4 UTSW 15 5234715 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGAACCTGGAAGCAAATTCCTGCC -3'
(R):5'- CATGAGAGCAGCTACATCACGTCAC -3'

Sequencing Primer
(F):5'- GCAAATTCCTGCCTCCGAG -3'
(R):5'- CGTGGCAAAGATAAATGGAGCAC -3'
Posted On2014-05-23