Incidental Mutation 'R1778:Tnxb'
ID197288
Institutional Source Beutler Lab
Gene Symbol Tnxb
Ensembl Gene ENSMUSG00000033327
Gene Nametenascin XB
SynonymsTnx, TN-MHC
MMRRC Submission 039809-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1778 (G1)
Quality Score210
Status Validated
Chromosome17
Chromosomal Location34670535-34719815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34683574 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1134 (I1134V)
Ref Sequence ENSEMBL: ENSMUSP00000084661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087399] [ENSMUST00000168533]
Predicted Effect probably benign
Transcript: ENSMUST00000087399
AA Change: I1134V

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000084661
Gene: ENSMUSG00000033327
AA Change: I1134V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
EGF 173 201 1.59e1 SMART
EGF 204 232 7.41e0 SMART
EGF 235 263 2.64e1 SMART
EGF 266 294 2.64e1 SMART
EGF 297 325 9.13e0 SMART
EGF 328 356 2.07e1 SMART
EGF_like 359 387 3.16e1 SMART
EGF_like 390 418 4.64e1 SMART
EGF_like 421 449 3.29e1 SMART
EGF_like 452 480 7.09e1 SMART
EGF 483 511 1.15e1 SMART
EGF 514 542 1.91e1 SMART
EGF_like 545 573 4.11e1 SMART
EGF 576 604 7.95e0 SMART
EGF 607 635 1.23e1 SMART
EGF_like 638 666 4.93e1 SMART
EGF_like 674 702 5.24e1 SMART
EGF 705 733 2.29e1 SMART
FN3 736 816 4.12e-3 SMART
FN3 827 904 1.21e-9 SMART
FN3 1047 1126 3.97e-5 SMART
FN3 1142 1223 3.62e-8 SMART
low complexity region 1230 1241 N/A INTRINSIC
FN3 1242 1320 2.31e-6 SMART
FN3 1351 1431 8.77e-7 SMART
FN3 1460 1539 3.01e-5 SMART
FN3 1556 1636 2.76e-4 SMART
FN3 1657 1736 5.78e-7 SMART
FN3 1752 1832 4.7e-7 SMART
FN3 1851 1929 1.95e-4 SMART
FN3 1955 2034 4.56e-5 SMART
FN3 2066 2145 2.23e-8 SMART
FN3 2164 2244 7.75e-8 SMART
FN3 2279 2358 8.5e-5 SMART
FN3 2387 2467 2.94e-8 SMART
FN3 2501 2580 1.7e-4 SMART
low complexity region 2588 2598 N/A INTRINSIC
FN3 2607 2687 6.75e-8 SMART
FN3 2716 2795 7.4e-5 SMART
FN3 2822 2902 1.35e-7 SMART
FN3 2931 3010 5.61e-5 SMART
FN3 3026 3106 6.01e-5 SMART
FN3 3120 3199 6.45e-5 SMART
FN3 3214 3293 9.54e-8 SMART
FN3 3316 3396 2.81e-5 SMART
FN3 3416 3502 1.98e-5 SMART
FN3 3518 3596 5.65e-10 SMART
FN3 3607 3682 7.63e-7 SMART
FN3 3695 3770 6.54e-6 SMART
FBG 3787 3997 8.88e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168533
AA Change: I1011V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000127487
Gene: ENSMUSG00000033327
AA Change: I1011V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
EGF 173 201 1.59e1 SMART
EGF 204 232 7.41e0 SMART
EGF 235 263 2.64e1 SMART
EGF 266 294 2.64e1 SMART
EGF 297 325 9.13e0 SMART
EGF 328 356 2.07e1 SMART
EGF_like 359 387 3.16e1 SMART
EGF_like 390 418 4.64e1 SMART
EGF_like 421 449 3.29e1 SMART
EGF_like 452 480 7.09e1 SMART
EGF 483 511 1.15e1 SMART
EGF 514 542 1.91e1 SMART
EGF_like 545 573 4.11e1 SMART
EGF 576 604 7.95e0 SMART
EGF 607 635 1.23e1 SMART
EGF_like 638 666 4.93e1 SMART
EGF_like 674 702 5.24e1 SMART
EGF 705 733 2.29e1 SMART
FN3 736 816 4.12e-3 SMART
FN3 827 904 1.21e-9 SMART
FN3 924 1003 3.97e-5 SMART
FN3 1019 1100 3.62e-8 SMART
low complexity region 1107 1118 N/A INTRINSIC
FN3 1119 1197 2.31e-6 SMART
FN3 1228 1308 8.77e-7 SMART
FN3 1337 1416 3.01e-5 SMART
FN3 1433 1513 2.76e-4 SMART
FN3 1534 1613 5.78e-7 SMART
FN3 1629 1709 4.7e-7 SMART
FN3 1728 1806 1.95e-4 SMART
FN3 1832 1911 4.56e-5 SMART
FN3 1943 2022 2.23e-8 SMART
FN3 2051 2130 5.61e-5 SMART
FN3 2146 2226 6.01e-5 SMART
FN3 2240 2319 6.45e-5 SMART
FN3 2334 2413 9.54e-8 SMART
FN3 2436 2516 2.81e-5 SMART
FN3 2536 2622 1.98e-5 SMART
FN3 2638 2716 5.65e-10 SMART
FN3 2727 2802 7.63e-7 SMART
FN3 2815 2890 6.54e-6 SMART
FBG 2907 3117 8.88e-125 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179962
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The tenascins have anti-adhesive effects, as opposed to fibronectin which is adhesive. This protein is thought to function in matrix maturation during wound healing, and its deficiency has been associated with the connective tissue disorder Ehlers-Danlos syndrome. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. It is one of four genes in this cluster which have been duplicated. The duplicated copy of this gene is incomplete and is a pseudogene which is transcribed but does not encode a protein. The structure of this gene is unusual in that it overlaps the CREBL1 and CYP21A2 genes at its 5' and 3' ends, respectively. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have stretchy skin, similar to patients with human Ehlers-Danlos syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G T 10: 77,982,944 A150S probably benign Het
4930432E11Rik T C 7: 29,560,706 noncoding transcript Het
4930568D16Rik A G 2: 35,354,983 M119T probably damaging Het
Aadacl2 A G 3: 60,017,450 probably null Het
Abca9 C T 11: 110,130,716 W1056* probably null Het
Adam20 A C 8: 40,796,661 T603P possibly damaging Het
Adgrl1 T C 8: 83,930,037 L323P probably damaging Het
Afap1l2 C T 19: 56,916,206 E628K possibly damaging Het
Ahctf1 A T 1: 179,753,015 L1874Q possibly damaging Het
Ak8 A G 2: 28,712,321 E89G probably benign Het
Aldh16a1 G A 7: 45,147,308 R256C probably damaging Het
Anxa5 G A 3: 36,465,331 T3M probably damaging Het
Arhgef16 T C 4: 154,287,986 K210E probably benign Het
Armc4 A T 18: 7,127,388 C942S probably damaging Het
Baz2b T C 2: 60,006,136 T18A unknown Het
BC037034 T C 5: 138,262,477 probably null Het
Bub1 A C 2: 127,803,122 I960M possibly damaging Het
Cbln2 G T 18: 86,713,147 D27Y probably benign Het
Ces2h C A 8: 105,014,607 P77Q possibly damaging Het
Chga T A 12: 102,561,700 M150K probably benign Het
Chmp3 A G 6: 71,577,807 E162G probably benign Het
Clip3 A G 7: 30,297,436 N161S probably damaging Het
Col12a1 T A 9: 79,604,585 probably benign Het
Cuedc2 C T 19: 46,331,640 G105D probably benign Het
Cyp2j7 A C 4: 96,199,390 F428V probably damaging Het
Ddx60 A G 8: 61,974,176 I762V possibly damaging Het
Def6 G A 17: 28,220,186 R257Q probably benign Het
Dkkl1 A T 7: 45,211,395 probably null Het
Dnah3 A G 7: 120,078,402 L433P probably damaging Het
Eif2s3y C T Y: 1,011,287 R33C probably benign Het
Elavl2 T A 4: 91,253,478 Y269F probably damaging Het
Esco2 A G 14: 65,831,262 S200P possibly damaging Het
Fam213b A T 4: 154,897,357 V151D probably damaging Het
Fcrl1 T A 3: 87,385,319 probably benign Het
Fhod1 C A 8: 105,329,677 D1135Y probably damaging Het
Fnbp1l T C 3: 122,590,147 N41D possibly damaging Het
Folh1 A T 7: 86,761,699 probably null Het
Fpr-rs7 T C 17: 20,114,015 D71G probably damaging Het
Gm10271 A G 10: 116,961,939 probably benign Het
Gm4841 A T 18: 60,270,948 Y24* probably null Het
Gm9825 A T 6: 7,983,124 noncoding transcript Het
Greb1 G A 12: 16,690,894 R1396C probably benign Het
Hectd1 C T 12: 51,753,807 C2076Y probably damaging Het
Hnrnpu A G 1: 178,325,241 probably benign Het
Ice2 T C 9: 69,415,648 I475T probably benign Het
Ifit1bl1 T A 19: 34,594,193 Q288L probably damaging Het
Ik T C 18: 36,756,818 probably benign Het
Kidins220 C T 12: 25,013,446 probably benign Het
Kmt2c T C 5: 25,372,974 D768G probably benign Het
Kmt2e A G 5: 23,492,364 T87A probably damaging Het
Lama5 G A 2: 180,195,481 probably benign Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Lrig2 A G 3: 104,467,366 probably benign Het
Lrig3 A G 10: 126,010,075 D791G probably damaging Het
Lrrc2 G A 9: 110,980,840 V315M probably benign Het
Lrrc4b A G 7: 44,462,399 D565G probably benign Het
Mpped1 C T 15: 83,791,990 probably benign Het
Msrb2 T A 2: 19,383,303 D87E probably benign Het
Muc20 T C 16: 32,794,141 T289A possibly damaging Het
Myo15 C A 11: 60,478,412 P666Q possibly damaging Het
Nfat5 C T 8: 107,361,789 P579L probably damaging Het
Nipbl A C 15: 8,319,488 M1920R probably damaging Het
Nuak1 T C 10: 84,374,874 probably null Het
Nup210l A G 3: 90,189,486 E1334G probably damaging Het
Olfr12 G A 1: 92,620,620 G238E possibly damaging Het
Olfr1410 A T 1: 92,608,109 N91Y possibly damaging Het
Olfr262 T A 19: 12,241,455 I69F probably benign Het
Olfr675 A T 7: 105,024,163 N272K probably benign Het
Olfr804 T C 10: 129,705,705 Y276H probably benign Het
P4ha3 A T 7: 100,300,691 probably null Het
Pbld2 C T 10: 63,054,371 A186V probably benign Het
Pcdh18 A T 3: 49,755,634 Y411N probably benign Het
Pgf A G 12: 85,171,767 S70P probably benign Het
Phrf1 T A 7: 141,232,456 D44E probably benign Het
Pla2g4a A G 1: 149,902,445 probably benign Het
Plce1 A G 19: 38,780,790 probably benign Het
Plxna2 A G 1: 194,810,970 N1851S probably benign Het
Prl7a2 G A 13: 27,659,271 T183I probably damaging Het
Ptger4 A T 15: 5,235,095 L335H probably damaging Het
Ptgr1 A G 4: 58,984,865 probably benign Het
Rdh7 A G 10: 127,884,721 S261P probably benign Het
Reg3a A G 6: 78,383,286 T150A probably benign Het
Rnf111 A G 9: 70,476,112 S180P probably benign Het
Rnf17 A G 14: 56,522,399 M1554V probably damaging Het
Rnf215 T A 11: 4,135,873 Y117* probably null Het
Rogdi T C 16: 5,010,505 T165A probably benign Het
Rpe65 A G 3: 159,622,848 Y431C probably damaging Het
Scube1 A G 15: 83,610,204 F844S probably damaging Het
Sdr16c6 T A 4: 4,058,814 E257D probably benign Het
Sim1 C A 10: 50,981,553 C466* probably null Het
Spi1 T A 2: 91,099,522 H46Q probably damaging Het
Sumf2 C A 5: 129,845,068 probably benign Het
Tbcb A G 7: 30,231,612 Y28H probably benign Het
Tecta C T 9: 42,343,631 C1752Y probably damaging Het
Tep1 T C 14: 50,829,622 probably benign Het
Tmem245 A T 4: 56,903,968 W591R probably damaging Het
Trim13 G T 14: 61,605,619 A362S probably benign Het
Trim47 T A 11: 116,109,820 D134V probably damaging Het
Ttc26 T A 6: 38,409,476 D377E possibly damaging Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vnn1 G T 10: 23,899,517 A222S possibly damaging Het
Wdr17 A G 8: 54,690,214 W110R probably damaging Het
Wwp1 G T 4: 19,627,892 Y700* probably null Het
Zbtb21 T C 16: 97,950,585 S661G probably benign Het
Zfp955b A G 17: 33,302,814 K419R probably benign Het
Other mutations in Tnxb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tnxb APN 17 34685629 missense probably damaging 1.00
IGL00424:Tnxb APN 17 34714692 missense probably damaging 1.00
IGL00486:Tnxb APN 17 34692382 missense probably damaging 1.00
IGL00952:Tnxb APN 17 34713128 missense probably damaging 1.00
IGL00974:Tnxb APN 17 34718733 critical splice donor site probably null
IGL01017:Tnxb APN 17 34693808 missense probably damaging 0.98
IGL01082:Tnxb APN 17 34714610 missense probably damaging 0.97
IGL01397:Tnxb APN 17 34714673 missense probably damaging 0.99
IGL01473:Tnxb APN 17 34685701 missense probably damaging 0.99
IGL01642:Tnxb APN 17 34718514 missense probably damaging 1.00
IGL01774:Tnxb APN 17 34688839 missense probably damaging 1.00
IGL01971:Tnxb APN 17 34672297 missense probably damaging 1.00
IGL02016:Tnxb APN 17 34672275 missense probably damaging 0.98
IGL02160:Tnxb APN 17 34714745 missense probably benign 0.01
IGL02473:Tnxb APN 17 34717762 missense probably damaging 1.00
IGL02666:Tnxb APN 17 34684939 missense probably benign 0.20
IGL02831:Tnxb APN 17 34703571 missense possibly damaging 0.93
IGL02838:Tnxb APN 17 34689632 missense possibly damaging 0.74
IGL02965:Tnxb APN 17 34709654 missense possibly damaging 0.93
IGL03155:Tnxb APN 17 34713595 missense probably damaging 1.00
IGL03194:Tnxb APN 17 34695947 nonsense probably null
IGL03215:Tnxb APN 17 34692525 missense possibly damaging 0.66
IGL03256:Tnxb APN 17 34688720 missense probably damaging 1.00
E0370:Tnxb UTSW 17 34678943 missense probably damaging 1.00
R0006:Tnxb UTSW 17 34682292 missense probably benign 0.07
R0049:Tnxb UTSW 17 34709568 missense possibly damaging 0.93
R0050:Tnxb UTSW 17 34673325 missense probably damaging 1.00
R0233:Tnxb UTSW 17 34699033 missense probably benign 0.32
R0233:Tnxb UTSW 17 34699033 missense probably benign 0.32
R0311:Tnxb UTSW 17 34716984 missense probably damaging 0.97
R0326:Tnxb UTSW 17 34698179 missense probably benign 0.32
R0387:Tnxb UTSW 17 34683574 missense probably benign 0.30
R0396:Tnxb UTSW 17 34671733 missense probably damaging 1.00
R0511:Tnxb UTSW 17 34718245 missense probably damaging 0.96
R0540:Tnxb UTSW 17 34671918 missense probably damaging 1.00
R0563:Tnxb UTSW 17 34716947 missense probably benign 0.05
R0575:Tnxb UTSW 17 34717206 missense possibly damaging 0.91
R0586:Tnxb UTSW 17 34672144 missense probably damaging 1.00
R0607:Tnxb UTSW 17 34671918 missense probably damaging 1.00
R0622:Tnxb UTSW 17 34718729 missense probably damaging 1.00
R0624:Tnxb UTSW 17 34683548 missense probably damaging 1.00
R0709:Tnxb UTSW 17 34689354 missense probably damaging 1.00
R0898:Tnxb UTSW 17 34670745 missense probably damaging 1.00
R0970:Tnxb UTSW 17 34698943 missense possibly damaging 0.85
R0972:Tnxb UTSW 17 34685143 missense probably damaging 1.00
R1118:Tnxb UTSW 17 34685043 missense probably damaging 1.00
R1119:Tnxb UTSW 17 34685043 missense probably damaging 1.00
R1226:Tnxb UTSW 17 34688929 missense probably damaging 1.00
R1296:Tnxb UTSW 17 34671577 missense probably damaging 1.00
R1297:Tnxb UTSW 17 34710166 missense probably damaging 0.96
R1349:Tnxb UTSW 17 34710293 missense possibly damaging 0.67
R1356:Tnxb UTSW 17 34695472 missense possibly damaging 0.53
R1372:Tnxb UTSW 17 34710293 missense possibly damaging 0.67
R1521:Tnxb UTSW 17 34711503 missense probably damaging 1.00
R1522:Tnxb UTSW 17 34718638 missense probably damaging 1.00
R1532:Tnxb UTSW 17 34710830 missense probably damaging 1.00
R1735:Tnxb UTSW 17 34717970 missense probably damaging 1.00
R1802:Tnxb UTSW 17 34703889 missense probably damaging 0.98
R1824:Tnxb UTSW 17 34692333 nonsense probably null
R1838:Tnxb UTSW 17 34678910 missense probably damaging 0.96
R1863:Tnxb UTSW 17 34670874 missense probably damaging 1.00
R1865:Tnxb UTSW 17 34703457 nonsense probably null
R1867:Tnxb UTSW 17 34671847 missense probably damaging 1.00
R1883:Tnxb UTSW 17 34689565 missense probably benign 0.01
R1884:Tnxb UTSW 17 34689565 missense probably benign 0.01
R1889:Tnxb UTSW 17 34695825 missense probably damaging 0.97
R1969:Tnxb UTSW 17 34679081 missense probably benign 0.20
R1989:Tnxb UTSW 17 34683377 missense probably benign 0.08
R1989:Tnxb UTSW 17 34693885 missense probably damaging 1.00
R1991:Tnxb UTSW 17 34671904 missense probably damaging 1.00
R1991:Tnxb UTSW 17 34682251 missense probably damaging 1.00
R1992:Tnxb UTSW 17 34671904 missense probably damaging 1.00
R2001:Tnxb UTSW 17 34692579 missense possibly damaging 0.82
R2018:Tnxb UTSW 17 34671750 missense probably benign 0.04
R2030:Tnxb UTSW 17 34718469 missense probably damaging 1.00
R2037:Tnxb UTSW 17 34699205 missense probably damaging 1.00
R2103:Tnxb UTSW 17 34682251 missense probably damaging 1.00
R2116:Tnxb UTSW 17 34672227 missense probably damaging 1.00
R2206:Tnxb UTSW 17 34709417 missense possibly damaging 0.86
R2207:Tnxb UTSW 17 34709417 missense possibly damaging 0.86
R2215:Tnxb UTSW 17 34704140 missense possibly damaging 0.93
R2413:Tnxb UTSW 17 34718278 missense probably damaging 0.99
R2680:Tnxb UTSW 17 34703620 missense possibly damaging 0.51
R2910:Tnxb UTSW 17 34672450 missense probably damaging 1.00
R2984:Tnxb UTSW 17 34678662 nonsense probably null
R3120:Tnxb UTSW 17 34692355 missense possibly damaging 0.86
R3429:Tnxb UTSW 17 34672631 nonsense probably null
R3429:Tnxb UTSW 17 34703587 missense probably damaging 0.98
R3552:Tnxb UTSW 17 34718721 missense probably damaging 1.00
R3698:Tnxb UTSW 17 34690433 critical splice donor site probably null
R3720:Tnxb UTSW 17 34712964 missense possibly damaging 0.95
R3841:Tnxb UTSW 17 34698923 missense possibly damaging 0.72
R3848:Tnxb UTSW 17 34690395 missense possibly damaging 0.82
R3886:Tnxb UTSW 17 34718911 missense probably damaging 1.00
R4074:Tnxb UTSW 17 34671871 missense probably benign 0.22
R4159:Tnxb UTSW 17 34711517 missense probably damaging 0.99
R4160:Tnxb UTSW 17 34711517 missense probably damaging 0.99
R4161:Tnxb UTSW 17 34711517 missense probably damaging 0.99
R4181:Tnxb UTSW 17 34709454 missense possibly damaging 0.93
R4210:Tnxb UTSW 17 34710977 missense possibly damaging 0.84
R4275:Tnxb UTSW 17 34698231 missense probably damaging 0.98
R4329:Tnxb UTSW 17 34693864 missense probably damaging 1.00
R4394:Tnxb UTSW 17 34678662 nonsense probably null
R4395:Tnxb UTSW 17 34678662 nonsense probably null
R4397:Tnxb UTSW 17 34678662 nonsense probably null
R4540:Tnxb UTSW 17 34703335 missense possibly damaging 0.86
R4673:Tnxb UTSW 17 34672540 missense probably damaging 0.99
R4719:Tnxb UTSW 17 34689420 missense probably damaging 1.00
R4725:Tnxb UTSW 17 34699067 missense probably damaging 0.99
R4753:Tnxb UTSW 17 34695935 missense possibly damaging 0.71
R4777:Tnxb UTSW 17 34671943 missense probably damaging 1.00
R4837:Tnxb UTSW 17 34718007 missense probably damaging 0.98
R4898:Tnxb UTSW 17 34695592 missense possibly damaging 0.95
R4938:Tnxb UTSW 17 34713632 missense probably damaging 1.00
R5044:Tnxb UTSW 17 34717483 missense probably damaging 1.00
R5100:Tnxb UTSW 17 34710928 missense probably damaging 0.99
R5223:Tnxb UTSW 17 34704078 missense possibly damaging 0.51
R5269:Tnxb UTSW 17 34703608 missense possibly damaging 0.95
R5333:Tnxb UTSW 17 34690231 missense probably damaging 1.00
R5454:Tnxb UTSW 17 34709625 missense possibly damaging 0.71
R5470:Tnxb UTSW 17 34716973 missense probably null 1.00
R5475:Tnxb UTSW 17 34689593 missense probably damaging 1.00
R5574:Tnxb UTSW 17 34711024 missense probably benign
R5596:Tnxb UTSW 17 34688804 missense probably damaging 1.00
R5599:Tnxb UTSW 17 34690202 missense probably damaging 1.00
R5599:Tnxb UTSW 17 34690205 missense probably benign 0.22
R5615:Tnxb UTSW 17 34683418 missense probably damaging 1.00
R5620:Tnxb UTSW 17 34717530 nonsense probably null
R5625:Tnxb UTSW 17 34685211 missense probably benign 0.30
R5734:Tnxb UTSW 17 34698910 missense possibly damaging 0.53
R5896:Tnxb UTSW 17 34672152 missense probably damaging 1.00
R5961:Tnxb UTSW 17 34718635 missense probably damaging 1.00
R5974:Tnxb UTSW 17 34685707 missense probably damaging 1.00
R6091:Tnxb UTSW 17 34710364 missense probably damaging 0.98
R6134:Tnxb UTSW 17 34672012 missense probably damaging 0.96
R6325:Tnxb UTSW 17 34692424 missense probably damaging 1.00
R6358:Tnxb UTSW 17 34678994 missense probably damaging 0.98
R6362:Tnxb UTSW 17 34694388 missense probably damaging 1.00
R6432:Tnxb UTSW 17 34717917 missense probably damaging 1.00
R6461:Tnxb UTSW 17 34671898 missense probably damaging 1.00
R6467:Tnxb UTSW 17 34693924 missense probably damaging 1.00
R6476:Tnxb UTSW 17 34690192 missense probably damaging 0.98
R6477:Tnxb UTSW 17 34719539 missense probably damaging 1.00
R6631:Tnxb UTSW 17 34718248 missense probably damaging 1.00
R6774:Tnxb UTSW 17 34709632 nonsense probably null
R6787:Tnxb UTSW 17 34710736 missense probably benign 0.02
R6805:Tnxb UTSW 17 34698153 missense possibly damaging 0.93
R6860:Tnxb UTSW 17 34713157 missense probably damaging 0.99
R6885:Tnxb UTSW 17 34718519 missense probably damaging 1.00
X0004:Tnxb UTSW 17 34703415 missense possibly damaging 0.71
X0010:Tnxb UTSW 17 34671934 missense probably damaging 1.00
X0019:Tnxb UTSW 17 34694189 missense possibly damaging 0.51
X0063:Tnxb UTSW 17 34703508 missense probably damaging 0.98
X0064:Tnxb UTSW 17 34694032 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACCACAGGGGACTCAAGACTC -3'
(R):5'- CGTCGTTCTGCTCTCTAGCCAAAAG -3'

Sequencing Primer
(F):5'- CTCTCCTTAAAGTCTAAGGGTACGG -3'
(R):5'- CAAAAGAGAGCTGTGCATTCTCTG -3'
Posted On2014-05-23