Incidental Mutation 'R1779:Trrap'
ID197333
Institutional Source Beutler Lab
Gene Symbol Trrap
Ensembl Gene ENSMUSG00000045482
Gene Nametransformation/transcription domain-associated protein
Synonymstransactivation/transformation-domain associated protein
MMRRC Submission 039810-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1779 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location144767732-144859778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 144828590 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 2539 (V2539I)
Ref Sequence ENSEMBL: ENSMUSP00000148419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]
Predicted Effect probably benign
Transcript: ENSMUST00000038980
AA Change: V2520I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: V2520I

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3363 3376 N/A INTRINSIC
low complexity region 3407 3418 N/A INTRINSIC
PI3Kc 3509 3798 5.11e-8 SMART
FATC 3797 3829 1.89e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094120
AA Change: V2538I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: V2538I

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1682 2e-6 SMART
low complexity region 1850 1861 N/A INTRINSIC
low complexity region 1884 1899 N/A INTRINSIC
low complexity region 2307 2321 N/A INTRINSIC
Pfam:FAT 2848 3203 1.1e-68 PFAM
low complexity region 3392 3405 N/A INTRINSIC
low complexity region 3436 3447 N/A INTRINSIC
PI3Kc 3538 3827 5.11e-8 SMART
FATC 3826 3858 1.89e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100467
AA Change: V2520I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: V2520I

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3381 3394 N/A INTRINSIC
low complexity region 3425 3436 N/A INTRINSIC
PI3Kc 3527 3816 5.11e-8 SMART
FATC 3815 3847 1.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132347
Predicted Effect unknown
Transcript: ENSMUST00000132925
AA Change: V2259I
SMART Domains Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482
AA Change: V2259I

DomainStartEndE-ValueType
low complexity region 197 242 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
SCOP:d1gw5a_ 474 1003 9e-7 SMART
Blast:PI3Kc 480 579 1e-13 BLAST
low complexity region 1083 1092 N/A INTRINSIC
low complexity region 1572 1583 N/A INTRINSIC
low complexity region 1606 1621 N/A INTRINSIC
low complexity region 2029 2043 N/A INTRINSIC
Pfam:FAT 2570 2914 1.5e-69 PFAM
low complexity region 3121 3134 N/A INTRINSIC
low complexity region 3165 3176 N/A INTRINSIC
PI3Kc 3267 3556 5.11e-8 SMART
FATC 3555 3587 1.89e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213013
AA Change: V2539I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T G 3: 124,406,514 L476F probably damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
4930432E11Rik A T 7: 29,579,166 noncoding transcript Het
A930011G23Rik A T 5: 99,223,038 probably benign Het
Abcd3 A G 3: 121,781,963 Y217H probably damaging Het
Abraxas1 A T 5: 100,817,956 probably benign Het
Acsbg1 T C 9: 54,616,062 Y427C probably damaging Het
Adam10 T A 9: 70,776,369 probably benign Het
Adam24 G A 8: 40,680,965 V491I possibly damaging Het
Adamts2 T G 11: 50,756,697 V299G probably damaging Het
Adh7 A G 3: 138,223,991 T143A probably damaging Het
Ahcyl1 A G 3: 107,674,103 S81P probably benign Het
Arhgap20 C A 9: 51,849,915 T986K probably benign Het
Atp13a5 A T 16: 29,314,660 I391N possibly damaging Het
Atp6v0a1 C A 11: 101,026,685 A143E probably benign Het
Calcrl A G 2: 84,351,285 I173T probably damaging Het
Casz1 A G 4: 148,932,937 T228A probably benign Het
Cckar A G 5: 53,699,979 I292T probably damaging Het
Cfhr2 T A 1: 139,858,645 probably null Het
Chkb T C 15: 89,429,057 I109V possibly damaging Het
Clec2i T C 6: 128,888,106 probably null Het
Clec4a4 T A 6: 123,023,975 W216R probably damaging Het
Cntnap1 A C 11: 101,186,511 I1000L probably damaging Het
Cp C A 3: 19,957,385 D34E possibly damaging Het
Cse1l T C 2: 166,940,124 probably null Het
Dennd3 T C 15: 73,522,508 probably null Het
Dnah7a A G 1: 53,577,223 V1193A probably benign Het
Eaf2 A G 16: 36,810,470 probably null Het
Ephb2 T C 4: 136,693,825 T405A possibly damaging Het
Fam117a G A 11: 95,378,953 V348M probably damaging Het
Fh1 T C 1: 175,601,424 *167W probably null Het
Fmo9 T A 1: 166,663,299 I486F probably benign Het
Gabbr1 T A 17: 37,054,879 I150N probably damaging Het
Gfpt1 T C 6: 87,077,197 V478A possibly damaging Het
Gm11639 T A 11: 104,720,939 S536T probably benign Het
Gm2663 A T 6: 40,997,960 V59E probably damaging Het
Gm4868 T A 5: 125,848,112 noncoding transcript Het
Heatr4 T A 12: 83,980,160 T108S probably benign Het
Hells G T 19: 38,946,842 A319S probably benign Het
Helz2 A G 2: 181,234,987 V1238A probably benign Het
Helz2 T A 2: 181,238,459 Q488L possibly damaging Het
Hkdc1 A G 10: 62,391,383 F765S probably damaging Het
Hspg2 T A 4: 137,518,509 W938R probably damaging Het
Itpr2 G A 6: 146,158,901 R2473* probably null Het
Kctd1 C T 18: 15,061,782 V595I probably benign Het
Krt7 A G 15: 101,423,409 Y369C probably damaging Het
Krt72 T C 15: 101,780,929 T323A probably benign Het
Krt76 A G 15: 101,892,687 L58P unknown Het
Liph C A 16: 21,968,050 R272L probably benign Het
Lrrc9 A T 12: 72,455,998 K248* probably null Het
Mei4 T A 9: 81,927,142 S93T probably damaging Het
Mgll T A 6: 88,813,948 Y183* probably null Het
Myo5b A G 18: 74,742,147 M1541V probably benign Het
Napg A G 18: 62,982,691 E66G probably benign Het
Npr3 T C 15: 11,851,486 D406G probably damaging Het
Nr2c2 A G 6: 92,159,243 T355A possibly damaging Het
Olfr1243 A T 2: 89,527,645 I255K probably benign Het
Olfr1461 T C 19: 13,165,040 Y9H probably benign Het
Olfr26 A G 9: 38,855,550 M163V possibly damaging Het
Olfr618 A T 7: 103,597,900 I195F probably damaging Het
Olfr624 A G 7: 103,670,638 I131T probably benign Het
Olfr631 G T 7: 103,929,461 V213L probably benign Het
Olfr71 G A 4: 43,706,041 H176Y probably damaging Het
Orai2 T C 5: 136,150,939 E80G probably damaging Het
Pcdhb14 T A 18: 37,449,482 V547E probably damaging Het
Pcdhb15 T C 18: 37,476,031 I772T possibly damaging Het
Pcnt T C 10: 76,408,796 Q1150R probably damaging Het
Pdcd6 A G 13: 74,305,581 I146T probably damaging Het
Phldb2 T A 16: 45,801,625 D664V probably damaging Het
Pik3ap1 A T 19: 41,332,234 V182E probably damaging Het
Pip4k2a A G 2: 18,847,622 V283A probably benign Het
Pkdrej A G 15: 85,821,171 V188A possibly damaging Het
Pnpla6 T C 8: 3,541,404 W1151R probably damaging Het
Ppp1r14c A G 10: 3,366,890 Y75C probably damaging Het
Prl2b1 C T 13: 27,383,469 D224N probably benign Het
Ptgis A G 2: 167,214,858 S270P probably benign Het
Rgs11 C A 17: 26,210,666 A446D probably damaging Het
Rims2 A G 15: 39,681,702 T1531A probably damaging Het
Sbno1 A T 5: 124,388,517 probably benign Het
Scarb2 C G 5: 92,448,557 M409I probably benign Het
Scube3 C T 17: 28,168,379 probably benign Het
Slc44a4 T C 17: 34,921,925 I180T probably damaging Het
Slc9a2 T C 1: 40,742,643 M344T probably damaging Het
Smc3 A T 19: 53,639,369 T860S probably benign Het
Snrpa A G 7: 27,191,749 I99T probably benign Het
Sorcs1 A G 19: 50,175,043 probably benign Het
Sorl1 C T 9: 41,991,482 probably null Het
Suds3 T C 5: 117,105,244 K143R probably benign Het
Supt20 A T 3: 54,714,743 M424L probably benign Het
Tgtp2 T C 11: 49,058,924 M274V probably benign Het
Tmem158 T A 9: 123,259,909 M213L probably benign Het
Tnks C A 8: 34,857,518 R639L probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trmt10c A C 16: 56,034,575 N232K possibly damaging Het
Trpm6 C T 19: 18,856,217 R1587W probably damaging Het
Tsg101 A G 7: 46,907,087 S115P probably benign Het
Ttll13 G T 7: 80,260,508 V800L probably benign Het
Vmn1r57 A G 7: 5,220,577 T34A possibly damaging Het
Vmn2r118 T A 17: 55,611,530 T121S probably benign Het
Wdr35 A G 12: 8,985,772 I238M possibly damaging Het
Wisp2 G A 2: 163,828,986 V138M probably damaging Het
Zfp81 T A 17: 33,335,106 T245S probably benign Het
Zfyve26 G T 12: 79,278,463 P824Q probably damaging Het
Other mutations in Trrap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Trrap APN 5 144779974 splice site probably benign
IGL00470:Trrap APN 5 144818038 missense probably damaging 1.00
IGL00490:Trrap APN 5 144825225 missense probably benign 0.40
IGL01072:Trrap APN 5 144784255 splice site probably benign
IGL01087:Trrap APN 5 144846539 missense probably damaging 0.99
IGL01300:Trrap APN 5 144804818 missense probably damaging 1.00
IGL01350:Trrap APN 5 144830969 missense possibly damaging 0.92
IGL01410:Trrap APN 5 144831021 missense probably benign 0.00
IGL01571:Trrap APN 5 144833287 splice site probably benign
IGL01748:Trrap APN 5 144833340 missense probably damaging 1.00
IGL01839:Trrap APN 5 144821875 missense probably damaging 1.00
IGL01976:Trrap APN 5 144856989 missense probably benign 0.00
IGL02075:Trrap APN 5 144828494 missense probably benign 0.00
IGL02127:Trrap APN 5 144816433 missense probably benign 0.22
IGL02131:Trrap APN 5 144840436 missense probably damaging 1.00
IGL02287:Trrap APN 5 144832538 missense probably damaging 1.00
IGL02301:Trrap APN 5 144777917 missense probably benign 0.05
IGL02336:Trrap APN 5 144798390 missense probably benign 0.39
IGL02526:Trrap APN 5 144824550 missense probably benign 0.00
IGL02873:Trrap APN 5 144841079 splice site probably benign
IGL02953:Trrap APN 5 144815964 missense probably damaging 0.99
IGL03404:Trrap APN 5 144833186 missense probably benign 0.00
Card-tower UTSW 5 144804766 missense probably damaging 1.00
PIT4243001:Trrap UTSW 5 144796971 missense probably benign 0.00
PIT4466001:Trrap UTSW 5 144828600 missense probably benign 0.02
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0112:Trrap UTSW 5 144822761 nonsense probably null
R0126:Trrap UTSW 5 144805750 nonsense probably null
R0257:Trrap UTSW 5 144804235 missense probably benign 0.31
R0325:Trrap UTSW 5 144816395 missense probably benign 0.05
R0376:Trrap UTSW 5 144816339 missense probably benign 0.03
R0396:Trrap UTSW 5 144814556 missense probably damaging 0.99
R0448:Trrap UTSW 5 144839567 missense possibly damaging 0.66
R0454:Trrap UTSW 5 144846477 missense probably damaging 1.00
R0711:Trrap UTSW 5 144853499 missense probably damaging 1.00
R0827:Trrap UTSW 5 144814830 missense probably benign 0.00
R1005:Trrap UTSW 5 144805727 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1179:Trrap UTSW 5 144777939 missense possibly damaging 0.94
R1218:Trrap UTSW 5 144816409 missense probably damaging 1.00
R1264:Trrap UTSW 5 144789599 splice site probably benign
R1374:Trrap UTSW 5 144846618 missense probably damaging 1.00
R1401:Trrap UTSW 5 144857422 missense possibly damaging 0.93
R1480:Trrap UTSW 5 144818313 missense probably benign
R1538:Trrap UTSW 5 144837202 missense possibly damaging 0.65
R1751:Trrap UTSW 5 144814575 critical splice donor site probably null
R1782:Trrap UTSW 5 144822703 missense possibly damaging 0.93
R1792:Trrap UTSW 5 144853586 missense possibly damaging 0.87
R1859:Trrap UTSW 5 144830951 missense probably benign 0.04
R1861:Trrap UTSW 5 144815917 splice site probably null
R1902:Trrap UTSW 5 144816053 missense probably damaging 1.00
R1903:Trrap UTSW 5 144816053 missense probably damaging 1.00
R2021:Trrap UTSW 5 144853488 missense possibly damaging 0.94
R2026:Trrap UTSW 5 144803044 missense possibly damaging 0.86
R2036:Trrap UTSW 5 144828562 missense probably benign 0.08
R2099:Trrap UTSW 5 144782239 missense possibly damaging 0.46
R2108:Trrap UTSW 5 144825874 missense probably benign 0.01
R2113:Trrap UTSW 5 144844211 missense probably damaging 1.00
R2174:Trrap UTSW 5 144821855 missense probably benign 0.40
R2442:Trrap UTSW 5 144817966 missense probably damaging 1.00
R2568:Trrap UTSW 5 144843369 critical splice donor site probably null
R3442:Trrap UTSW 5 144792252 missense probably benign 0.03
R3853:Trrap UTSW 5 144792165 missense probably damaging 1.00
R4401:Trrap UTSW 5 144843318 missense possibly damaging 0.60
R4493:Trrap UTSW 5 144831048 missense probably benign 0.21
R4524:Trrap UTSW 5 144825321 missense probably benign 0.38
R4569:Trrap UTSW 5 144792118 missense probably benign 0.13
R4672:Trrap UTSW 5 144785480 missense probably damaging 0.97
R4732:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4733:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4791:Trrap UTSW 5 144803277 missense probably damaging 1.00
R4795:Trrap UTSW 5 144832488 missense probably benign 0.06
R4827:Trrap UTSW 5 144800948 missense probably benign 0.02
R4839:Trrap UTSW 5 144845592 missense probably damaging 1.00
R4915:Trrap UTSW 5 144805735 missense probably damaging 0.99
R4951:Trrap UTSW 5 144805720 missense possibly damaging 0.65
R4959:Trrap UTSW 5 144856960 missense probably damaging 1.00
R5049:Trrap UTSW 5 144826717 missense probably damaging 1.00
R5074:Trrap UTSW 5 144851179 missense probably damaging 1.00
R5236:Trrap UTSW 5 144817786 missense probably benign 0.07
R5281:Trrap UTSW 5 144813503 missense probably benign 0.13
R5322:Trrap UTSW 5 144844224 missense probably damaging 1.00
R5457:Trrap UTSW 5 144849977 missense probably damaging 1.00
R5590:Trrap UTSW 5 144782265 missense probably benign 0.05
R5799:Trrap UTSW 5 144830945 missense probably benign
R5885:Trrap UTSW 5 144794793 missense probably damaging 1.00
R5905:Trrap UTSW 5 144849920 missense possibly damaging 0.95
R5908:Trrap UTSW 5 144786708 missense probably damaging 0.96
R5956:Trrap UTSW 5 144807391 splice site silent
R5992:Trrap UTSW 5 144810184 missense probably benign 0.00
R6017:Trrap UTSW 5 144844241 missense probably damaging 1.00
R6029:Trrap UTSW 5 144817679 missense possibly damaging 0.94
R6029:Trrap UTSW 5 144825914 missense possibly damaging 0.75
R6117:Trrap UTSW 5 144802961 missense possibly damaging 0.78
R6166:Trrap UTSW 5 144781981 missense possibly damaging 0.66
R6234:Trrap UTSW 5 144839713 intron probably null
R6288:Trrap UTSW 5 144811992 missense probably damaging 1.00
R6290:Trrap UTSW 5 144805018 missense probably damaging 1.00
R6316:Trrap UTSW 5 144813526 missense probably benign 0.02
R6398:Trrap UTSW 5 144790870 missense possibly damaging 0.83
R6413:Trrap UTSW 5 144784046 missense possibly damaging 0.83
R6499:Trrap UTSW 5 144857002 missense probably damaging 1.00
R6529:Trrap UTSW 5 144834204 missense probably benign 0.06
R6574:Trrap UTSW 5 144815550 critical splice donor site probably null
R6631:Trrap UTSW 5 144771650 missense possibly damaging 0.94
R6727:Trrap UTSW 5 144856950 missense probably damaging 1.00
R6776:Trrap UTSW 5 144851256 nonsense probably null
R6914:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6942:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6945:Trrap UTSW 5 144790855 missense possibly damaging 0.66
R7023:Trrap UTSW 5 144792154 missense possibly damaging 0.64
R7107:Trrap UTSW 5 144797135 missense probably benign 0.05
R7139:Trrap UTSW 5 144803178 missense possibly damaging 0.65
R7148:Trrap UTSW 5 144821803 missense possibly damaging 0.77
R7167:Trrap UTSW 5 144839614 missense probably benign 0.39
R7171:Trrap UTSW 5 144794049 missense probably damaging 1.00
R7205:Trrap UTSW 5 144842707 missense possibly damaging 0.94
R7215:Trrap UTSW 5 144797135 missense probably benign 0.05
R7255:Trrap UTSW 5 144858954 missense probably damaging 1.00
R7261:Trrap UTSW 5 144845477 missense possibly damaging 0.67
R7264:Trrap UTSW 5 144814523 missense probably benign 0.05
R7372:Trrap UTSW 5 144789398 missense probably benign
X0060:Trrap UTSW 5 144843361 missense probably damaging 0.96
Z1088:Trrap UTSW 5 144834197 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCTGATGCTAAGCCAGAGGAAG -3'
(R):5'- GCTGGACATGCCAAATGAGATGC -3'

Sequencing Primer
(F):5'- TGCAGCTAACCTGCACTG -3'
(R):5'- GACATGCCAAATGAGATGCTTTTC -3'
Posted On2014-05-23