Incidental Mutation 'R1779:Tsg101'
ID197345
Institutional Source Beutler Lab
Gene Symbol Tsg101
Ensembl Gene ENSMUSG00000014402
Gene Nametumor susceptibility gene 101
SynonymsCC2
MMRRC Submission 039810-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1779 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46888949-46919969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46907087 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 115 (S115P)
Ref Sequence ENSEMBL: ENSMUSP00000147749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014546] [ENSMUST00000143413] [ENSMUST00000156335] [ENSMUST00000209538] [ENSMUST00000210664] [ENSMUST00000211076]
Predicted Effect probably benign
Transcript: ENSMUST00000014546
AA Change: S150P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000014546
Gene: ENSMUSG00000014402
AA Change: S150P

DomainStartEndE-ValueType
UBCc 22 177 5.96e-4 SMART
PDB:3IV1|H 229 305 1e-43 PDB
Pfam:Vps23_core 317 380 2.5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140693
Predicted Effect probably benign
Transcript: ENSMUST00000143413
AA Change: S128P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121314
Gene: ENSMUSG00000014402
AA Change: S128P

DomainStartEndE-ValueType
UBCc 17 138 1.05e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156335
AA Change: S56P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120856
Gene: ENSMUSG00000014402
AA Change: S56P

DomainStartEndE-ValueType
UBCc 51 206 5.96e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209538
AA Change: S65P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210664
AA Change: S115P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000211076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211595
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a group of apparently inactive homologs of ubiquitin-conjugating enzymes. The gene product contains a coiled-coil domain that interacts with stathmin, a cytosolic phosphoprotein implicated in tumorigenesis. The protein may play a role in cell growth and differentiation and act as a negative growth regulator. In vitro steady-state expression of this tumor susceptibility gene appears to be important for maintenance of genomic stability and cell cycle regulation. Mutations and alternative splicing in this gene occur in high frequency in breast cancer and suggest that defects occur during breast cancer tumorigenesis and/or progression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced growth, fail to form mesoderm, accumulate p53 protein and die by embryonic day 6.5. Homozygotes for a mammary gland-specific knockout show impaired mammogenesis and are unable to nurse their pups. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T G 3: 124,406,514 L476F probably damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
4930432E11Rik A T 7: 29,579,166 noncoding transcript Het
A930011G23Rik A T 5: 99,223,038 probably benign Het
Abcd3 A G 3: 121,781,963 Y217H probably damaging Het
Abraxas1 A T 5: 100,817,956 probably benign Het
Acsbg1 T C 9: 54,616,062 Y427C probably damaging Het
Adam10 T A 9: 70,776,369 probably benign Het
Adam24 G A 8: 40,680,965 V491I possibly damaging Het
Adamts2 T G 11: 50,756,697 V299G probably damaging Het
Adh7 A G 3: 138,223,991 T143A probably damaging Het
Ahcyl1 A G 3: 107,674,103 S81P probably benign Het
Arhgap20 C A 9: 51,849,915 T986K probably benign Het
Atp13a5 A T 16: 29,314,660 I391N possibly damaging Het
Atp6v0a1 C A 11: 101,026,685 A143E probably benign Het
Calcrl A G 2: 84,351,285 I173T probably damaging Het
Casz1 A G 4: 148,932,937 T228A probably benign Het
Cckar A G 5: 53,699,979 I292T probably damaging Het
Cfhr2 T A 1: 139,858,645 probably null Het
Chkb T C 15: 89,429,057 I109V possibly damaging Het
Clec2i T C 6: 128,888,106 probably null Het
Clec4a4 T A 6: 123,023,975 W216R probably damaging Het
Cntnap1 A C 11: 101,186,511 I1000L probably damaging Het
Cp C A 3: 19,957,385 D34E possibly damaging Het
Cse1l T C 2: 166,940,124 probably null Het
Dennd3 T C 15: 73,522,508 probably null Het
Dnah7a A G 1: 53,577,223 V1193A probably benign Het
Eaf2 A G 16: 36,810,470 probably null Het
Ephb2 T C 4: 136,693,825 T405A possibly damaging Het
Fam117a G A 11: 95,378,953 V348M probably damaging Het
Fh1 T C 1: 175,601,424 *167W probably null Het
Fmo9 T A 1: 166,663,299 I486F probably benign Het
Gabbr1 T A 17: 37,054,879 I150N probably damaging Het
Gfpt1 T C 6: 87,077,197 V478A possibly damaging Het
Gm11639 T A 11: 104,720,939 S536T probably benign Het
Gm2663 A T 6: 40,997,960 V59E probably damaging Het
Gm4868 T A 5: 125,848,112 noncoding transcript Het
Heatr4 T A 12: 83,980,160 T108S probably benign Het
Hells G T 19: 38,946,842 A319S probably benign Het
Helz2 A G 2: 181,234,987 V1238A probably benign Het
Helz2 T A 2: 181,238,459 Q488L possibly damaging Het
Hkdc1 A G 10: 62,391,383 F765S probably damaging Het
Hspg2 T A 4: 137,518,509 W938R probably damaging Het
Itpr2 G A 6: 146,158,901 R2473* probably null Het
Kctd1 C T 18: 15,061,782 V595I probably benign Het
Krt7 A G 15: 101,423,409 Y369C probably damaging Het
Krt72 T C 15: 101,780,929 T323A probably benign Het
Krt76 A G 15: 101,892,687 L58P unknown Het
Liph C A 16: 21,968,050 R272L probably benign Het
Lrrc9 A T 12: 72,455,998 K248* probably null Het
Mei4 T A 9: 81,927,142 S93T probably damaging Het
Mgll T A 6: 88,813,948 Y183* probably null Het
Myo5b A G 18: 74,742,147 M1541V probably benign Het
Napg A G 18: 62,982,691 E66G probably benign Het
Npr3 T C 15: 11,851,486 D406G probably damaging Het
Nr2c2 A G 6: 92,159,243 T355A possibly damaging Het
Olfr1243 A T 2: 89,527,645 I255K probably benign Het
Olfr1461 T C 19: 13,165,040 Y9H probably benign Het
Olfr26 A G 9: 38,855,550 M163V possibly damaging Het
Olfr618 A T 7: 103,597,900 I195F probably damaging Het
Olfr624 A G 7: 103,670,638 I131T probably benign Het
Olfr631 G T 7: 103,929,461 V213L probably benign Het
Olfr71 G A 4: 43,706,041 H176Y probably damaging Het
Orai2 T C 5: 136,150,939 E80G probably damaging Het
Pcdhb14 T A 18: 37,449,482 V547E probably damaging Het
Pcdhb15 T C 18: 37,476,031 I772T possibly damaging Het
Pcnt T C 10: 76,408,796 Q1150R probably damaging Het
Pdcd6 A G 13: 74,305,581 I146T probably damaging Het
Phldb2 T A 16: 45,801,625 D664V probably damaging Het
Pik3ap1 A T 19: 41,332,234 V182E probably damaging Het
Pip4k2a A G 2: 18,847,622 V283A probably benign Het
Pkdrej A G 15: 85,821,171 V188A possibly damaging Het
Pnpla6 T C 8: 3,541,404 W1151R probably damaging Het
Ppp1r14c A G 10: 3,366,890 Y75C probably damaging Het
Prl2b1 C T 13: 27,383,469 D224N probably benign Het
Ptgis A G 2: 167,214,858 S270P probably benign Het
Rgs11 C A 17: 26,210,666 A446D probably damaging Het
Rims2 A G 15: 39,681,702 T1531A probably damaging Het
Sbno1 A T 5: 124,388,517 probably benign Het
Scarb2 C G 5: 92,448,557 M409I probably benign Het
Scube3 C T 17: 28,168,379 probably benign Het
Slc44a4 T C 17: 34,921,925 I180T probably damaging Het
Slc9a2 T C 1: 40,742,643 M344T probably damaging Het
Smc3 A T 19: 53,639,369 T860S probably benign Het
Snrpa A G 7: 27,191,749 I99T probably benign Het
Sorcs1 A G 19: 50,175,043 probably benign Het
Sorl1 C T 9: 41,991,482 probably null Het
Suds3 T C 5: 117,105,244 K143R probably benign Het
Supt20 A T 3: 54,714,743 M424L probably benign Het
Tgtp2 T C 11: 49,058,924 M274V probably benign Het
Tmem158 T A 9: 123,259,909 M213L probably benign Het
Tnks C A 8: 34,857,518 R639L probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trmt10c A C 16: 56,034,575 N232K possibly damaging Het
Trpm6 C T 19: 18,856,217 R1587W probably damaging Het
Trrap G A 5: 144,828,590 V2539I probably benign Het
Ttll13 G T 7: 80,260,508 V800L probably benign Het
Vmn1r57 A G 7: 5,220,577 T34A possibly damaging Het
Vmn2r118 T A 17: 55,611,530 T121S probably benign Het
Wdr35 A G 12: 8,985,772 I238M possibly damaging Het
Wisp2 G A 2: 163,828,986 V138M probably damaging Het
Zfp81 T A 17: 33,335,106 T245S probably benign Het
Zfyve26 G T 12: 79,278,463 P824Q probably damaging Het
Other mutations in Tsg101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Tsg101 APN 7 46908925 missense probably damaging 1.00
IGL01505:Tsg101 APN 7 46909060 missense probably damaging 1.00
R1183:Tsg101 UTSW 7 46889624 missense probably benign 0.23
R1558:Tsg101 UTSW 7 46889689 missense probably damaging 1.00
R1560:Tsg101 UTSW 7 46892460 unclassified probably null
R2015:Tsg101 UTSW 7 46908904 critical splice donor site probably null
R2329:Tsg101 UTSW 7 46891120 missense probably damaging 1.00
R3773:Tsg101 UTSW 7 46889615 makesense probably null
R4108:Tsg101 UTSW 7 46892494 missense probably damaging 1.00
R4618:Tsg101 UTSW 7 46892509 missense possibly damaging 0.76
R5162:Tsg101 UTSW 7 46892426 missense probably damaging 1.00
R5380:Tsg101 UTSW 7 46891120 missense probably damaging 1.00
R5537:Tsg101 UTSW 7 46891128 missense probably benign 0.02
R6939:Tsg101 UTSW 7 46907099 missense probably benign 0.00
X0063:Tsg101 UTSW 7 46889631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCCTCAGAATACTTCCCAAAACG -3'
(R):5'- TTACTGGAAGGCTTGTGCCTGC -3'

Sequencing Primer
(F):5'- GCCACTAACTTGACAAGCTAAAAAG -3'
(R):5'- gacctcagcacacaccc -3'
Posted On2014-05-23