Incidental Mutation 'R1779:Pcdhb14'
ID197401
Institutional Source Beutler Lab
Gene Symbol Pcdhb14
Ensembl Gene ENSMUSG00000044043
Gene Nameprotocadherin beta 14
SynonymsPcdhbN, 2210006M07Rik, Pcdhb17
MMRRC Submission 039810-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R1779 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37447656-37456350 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37449482 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 547 (V547E)
Ref Sequence ENSEMBL: ENSMUSP00000054111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052387] [ENSMUST00000056915] [ENSMUST00000115661] [ENSMUST00000194544]
PDB Structure
Solution structure of mouse protocadherin beta 14 (26-137) [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000052387
AA Change: V547E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054111
Gene: ENSMUSG00000044043
AA Change: V547E

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 1.4e-35 PFAM
CA 155 240 1.53e-20 SMART
CA 264 345 3.52e-29 SMART
CA 368 449 2.24e-22 SMART
CA 473 559 2.38e-26 SMART
CA 589 670 4.12e-12 SMART
Pfam:Cadherin_C_2 685 768 4.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056915
SMART Domains Protein: ENSMUSP00000061087
Gene: ENSMUSG00000047307

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 58 130 5.5e-1 SMART
CA 154 239 8.55e-19 SMART
CA 263 343 3.36e-26 SMART
CA 366 447 2.24e-22 SMART
CA 471 557 1.08e-24 SMART
CA 587 668 1.25e-11 SMART
Pfam:Cadherin_C_2 685 768 2.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.0288 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 97% (101/104)
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T G 3: 124,406,514 L476F probably damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
4930432E11Rik A T 7: 29,579,166 noncoding transcript Het
A930011G23Rik A T 5: 99,223,038 probably benign Het
Abcd3 A G 3: 121,781,963 Y217H probably damaging Het
Abraxas1 A T 5: 100,817,956 probably benign Het
Acsbg1 T C 9: 54,616,062 Y427C probably damaging Het
Adam10 T A 9: 70,776,369 probably benign Het
Adam24 G A 8: 40,680,965 V491I possibly damaging Het
Adamts2 T G 11: 50,756,697 V299G probably damaging Het
Adh7 A G 3: 138,223,991 T143A probably damaging Het
Ahcyl1 A G 3: 107,674,103 S81P probably benign Het
Arhgap20 C A 9: 51,849,915 T986K probably benign Het
Atp13a5 A T 16: 29,314,660 I391N possibly damaging Het
Atp6v0a1 C A 11: 101,026,685 A143E probably benign Het
Calcrl A G 2: 84,351,285 I173T probably damaging Het
Casz1 A G 4: 148,932,937 T228A probably benign Het
Cckar A G 5: 53,699,979 I292T probably damaging Het
Cfhr2 T A 1: 139,858,645 probably null Het
Chkb T C 15: 89,429,057 I109V possibly damaging Het
Clec2i T C 6: 128,888,106 probably null Het
Clec4a4 T A 6: 123,023,975 W216R probably damaging Het
Cntnap1 A C 11: 101,186,511 I1000L probably damaging Het
Cp C A 3: 19,957,385 D34E possibly damaging Het
Cse1l T C 2: 166,940,124 probably null Het
Dennd3 T C 15: 73,522,508 probably null Het
Dnah7a A G 1: 53,577,223 V1193A probably benign Het
Eaf2 A G 16: 36,810,470 probably null Het
Ephb2 T C 4: 136,693,825 T405A possibly damaging Het
Fam117a G A 11: 95,378,953 V348M probably damaging Het
Fh1 T C 1: 175,601,424 *167W probably null Het
Fmo9 T A 1: 166,663,299 I486F probably benign Het
Gabbr1 T A 17: 37,054,879 I150N probably damaging Het
Gfpt1 T C 6: 87,077,197 V478A possibly damaging Het
Gm11639 T A 11: 104,720,939 S536T probably benign Het
Gm2663 A T 6: 40,997,960 V59E probably damaging Het
Gm4868 T A 5: 125,848,112 noncoding transcript Het
Heatr4 T A 12: 83,980,160 T108S probably benign Het
Hells G T 19: 38,946,842 A319S probably benign Het
Helz2 A G 2: 181,234,987 V1238A probably benign Het
Helz2 T A 2: 181,238,459 Q488L possibly damaging Het
Hkdc1 A G 10: 62,391,383 F765S probably damaging Het
Hspg2 T A 4: 137,518,509 W938R probably damaging Het
Itpr2 G A 6: 146,158,901 R2473* probably null Het
Kctd1 C T 18: 15,061,782 V595I probably benign Het
Krt7 A G 15: 101,423,409 Y369C probably damaging Het
Krt72 T C 15: 101,780,929 T323A probably benign Het
Krt76 A G 15: 101,892,687 L58P unknown Het
Liph C A 16: 21,968,050 R272L probably benign Het
Lrrc9 A T 12: 72,455,998 K248* probably null Het
Mei4 T A 9: 81,927,142 S93T probably damaging Het
Mgll T A 6: 88,813,948 Y183* probably null Het
Myo5b A G 18: 74,742,147 M1541V probably benign Het
Napg A G 18: 62,982,691 E66G probably benign Het
Npr3 T C 15: 11,851,486 D406G probably damaging Het
Nr2c2 A G 6: 92,159,243 T355A possibly damaging Het
Olfr1243 A T 2: 89,527,645 I255K probably benign Het
Olfr1461 T C 19: 13,165,040 Y9H probably benign Het
Olfr26 A G 9: 38,855,550 M163V possibly damaging Het
Olfr618 A T 7: 103,597,900 I195F probably damaging Het
Olfr624 A G 7: 103,670,638 I131T probably benign Het
Olfr631 G T 7: 103,929,461 V213L probably benign Het
Olfr71 G A 4: 43,706,041 H176Y probably damaging Het
Orai2 T C 5: 136,150,939 E80G probably damaging Het
Pcdhb15 T C 18: 37,476,031 I772T possibly damaging Het
Pcnt T C 10: 76,408,796 Q1150R probably damaging Het
Pdcd6 A G 13: 74,305,581 I146T probably damaging Het
Phldb2 T A 16: 45,801,625 D664V probably damaging Het
Pik3ap1 A T 19: 41,332,234 V182E probably damaging Het
Pip4k2a A G 2: 18,847,622 V283A probably benign Het
Pkdrej A G 15: 85,821,171 V188A possibly damaging Het
Pnpla6 T C 8: 3,541,404 W1151R probably damaging Het
Ppp1r14c A G 10: 3,366,890 Y75C probably damaging Het
Prl2b1 C T 13: 27,383,469 D224N probably benign Het
Ptgis A G 2: 167,214,858 S270P probably benign Het
Rgs11 C A 17: 26,210,666 A446D probably damaging Het
Rims2 A G 15: 39,681,702 T1531A probably damaging Het
Sbno1 A T 5: 124,388,517 probably benign Het
Scarb2 C G 5: 92,448,557 M409I probably benign Het
Scube3 C T 17: 28,168,379 probably benign Het
Slc44a4 T C 17: 34,921,925 I180T probably damaging Het
Slc9a2 T C 1: 40,742,643 M344T probably damaging Het
Smc3 A T 19: 53,639,369 T860S probably benign Het
Snrpa A G 7: 27,191,749 I99T probably benign Het
Sorcs1 A G 19: 50,175,043 probably benign Het
Sorl1 C T 9: 41,991,482 probably null Het
Suds3 T C 5: 117,105,244 K143R probably benign Het
Supt20 A T 3: 54,714,743 M424L probably benign Het
Tgtp2 T C 11: 49,058,924 M274V probably benign Het
Tmem158 T A 9: 123,259,909 M213L probably benign Het
Tnks C A 8: 34,857,518 R639L probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trmt10c A C 16: 56,034,575 N232K possibly damaging Het
Trpm6 C T 19: 18,856,217 R1587W probably damaging Het
Trrap G A 5: 144,828,590 V2539I probably benign Het
Tsg101 A G 7: 46,907,087 S115P probably benign Het
Ttll13 G T 7: 80,260,508 V800L probably benign Het
Vmn1r57 A G 7: 5,220,577 T34A possibly damaging Het
Vmn2r118 T A 17: 55,611,530 T121S probably benign Het
Wdr35 A G 12: 8,985,772 I238M possibly damaging Het
Wisp2 G A 2: 163,828,986 V138M probably damaging Het
Zfp81 T A 17: 33,335,106 T245S probably benign Het
Zfyve26 G T 12: 79,278,463 P824Q probably damaging Het
Other mutations in Pcdhb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Pcdhb14 APN 18 37450033 missense probably benign 0.28
IGL02314:Pcdhb14 APN 18 37450195 missense probably benign 0.03
IGL02411:Pcdhb14 APN 18 37449770 missense possibly damaging 0.78
IGL02553:Pcdhb14 APN 18 37448018 nonsense probably null
IGL02797:Pcdhb14 APN 18 37449851 missense probably damaging 1.00
IGL03184:Pcdhb14 APN 18 37449032 missense probably benign 0.00
IGL03352:Pcdhb14 APN 18 37449004 missense possibly damaging 0.67
R0166:Pcdhb14 UTSW 18 37448489 unclassified probably null
R0467:Pcdhb14 UTSW 18 37449224 missense probably damaging 0.98
R0675:Pcdhb14 UTSW 18 37448339 missense possibly damaging 0.91
R0730:Pcdhb14 UTSW 18 37448868 missense probably damaging 1.00
R1119:Pcdhb14 UTSW 18 37448587 missense probably damaging 0.99
R1121:Pcdhb14 UTSW 18 37449592 missense probably damaging 1.00
R1338:Pcdhb14 UTSW 18 37449890 missense probably benign 0.00
R1726:Pcdhb14 UTSW 18 37449594 nonsense probably null
R1743:Pcdhb14 UTSW 18 37448178 missense probably benign 0.01
R1795:Pcdhb14 UTSW 18 37449535 missense probably benign
R2131:Pcdhb14 UTSW 18 37447870 missense probably benign 0.00
R2133:Pcdhb14 UTSW 18 37447870 missense probably benign 0.00
R3792:Pcdhb14 UTSW 18 37449662 missense probably damaging 1.00
R3916:Pcdhb14 UTSW 18 37448545 missense possibly damaging 0.48
R4197:Pcdhb14 UTSW 18 37448305 missense probably benign 0.01
R4282:Pcdhb14 UTSW 18 37450142 missense probably damaging 1.00
R4657:Pcdhb14 UTSW 18 37448847 missense possibly damaging 0.92
R4801:Pcdhb14 UTSW 18 37448278 missense probably benign 0.28
R4802:Pcdhb14 UTSW 18 37448278 missense probably benign 0.28
R5022:Pcdhb14 UTSW 18 37450170 missense probably benign 0.03
R5034:Pcdhb14 UTSW 18 37448806 missense probably damaging 0.98
R5664:Pcdhb14 UTSW 18 37448996 missense possibly damaging 0.54
R5840:Pcdhb14 UTSW 18 37448750 missense probably benign 0.23
R5966:Pcdhb14 UTSW 18 37448242 missense probably benign
R6090:Pcdhb14 UTSW 18 37448606 missense probably benign 0.45
R6148:Pcdhb14 UTSW 18 37449230 missense probably damaging 1.00
R6187:Pcdhb14 UTSW 18 37448444 missense probably damaging 1.00
R6972:Pcdhb14 UTSW 18 37449692 missense probably damaging 1.00
X0065:Pcdhb14 UTSW 18 37449421 missense possibly damaging 0.95
X0065:Pcdhb14 UTSW 18 37449984 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCTGACATCAATGACAACGCCC -3'
(R):5'- ATTGTGCGCCCACACACTGAAC -3'

Sequencing Primer
(F):5'- TGTTTGTCCGAGAAAACAACAGC -3'
(R):5'- TCTTGAGCAGTTGGAATGACAG -3'
Posted On2014-05-23