Incidental Mutation 'R1780:Aff3'
ID197413
Institutional Source Beutler Lab
Gene Symbol Aff3
Ensembl Gene ENSMUSG00000037138
Gene NameAF4/FMR2 family, member 3
SynonymsLaf4, LAF-4, 3222402O04Rik
MMRRC Submission 039811-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R1780 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location38177326-38664955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38535702 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 66 (S66T)
Ref Sequence ENSEMBL: ENSMUSP00000092637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039827] [ENSMUST00000095027] [ENSMUST00000134963] [ENSMUST00000212668]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000027250
SMART Domains Protein: ENSMUSP00000027250
Gene: ENSMUSG00000037138

DomainStartEndE-ValueType
Pfam:AF-4 20 171 2.7e-48 PFAM
Pfam:AF-4 159 350 2.6e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000039827
AA Change: S66T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044128
Gene: ENSMUSG00000037138
AA Change: S66T

DomainStartEndE-ValueType
Pfam:AF-4 20 170 4.9e-63 PFAM
Pfam:AF-4 160 1226 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095027
AA Change: S66T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092637
Gene: ENSMUSG00000037138
AA Change: S66T

DomainStartEndE-ValueType
Pfam:AF-4 20 172 1.7e-47 PFAM
Pfam:AF-4 161 1226 3.8e-268 PFAM
Predicted Effect silent
Transcript: ENSMUST00000134963
Predicted Effect probably damaging
Transcript: ENSMUST00000212668
AA Change: S91T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tissue-restricted nuclear transcriptional activator that is preferentially expressed in lymphoid tissue. Isolation of this protein initially defined a highly conserved LAF4/MLLT2 gene family of nuclear transcription factors that may function in lymphoid development and oncogenesis. In some ALL patients, this gene has been found fused to the gene for MLL. Multiple alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,852,593 E493G probably damaging Het
Ankrd17 T A 5: 90,232,415 K2470N probably damaging Het
Ap3m1 T C 14: 21,041,070 T156A probably benign Het
Arhgef4 T A 1: 34,724,160 S832R possibly damaging Het
Asb10 T C 5: 24,533,676 D423G possibly damaging Het
Ash1l A G 3: 88,965,984 T25A probably benign Het
Atp13a2 T A 4: 141,002,460 L663I possibly damaging Het
Atp9b A T 18: 80,776,897 Y174* probably null Het
Bche A G 3: 73,700,620 I491T probably benign Het
Bckdhb T C 9: 83,953,783 probably null Het
Cadps2 C T 6: 23,320,932 probably null Het
Cdc42bpb A T 12: 111,322,907 V468E probably damaging Het
Chrnd T C 1: 87,192,548 V33A possibly damaging Het
Col6a5 A T 9: 105,936,878 V645D unknown Het
Cpa1 C T 6: 30,643,008 L312F probably damaging Het
Cyp2a5 A G 7: 26,841,876 probably benign Het
Cyp2c39 C A 19: 39,538,851 probably benign Het
Cyp2d26 T C 15: 82,794,007 N56S probably damaging Het
Ddx21 A G 10: 62,594,147 probably benign Het
Dnah11 A T 12: 118,027,558 C2358S probably damaging Het
Entpd8 T C 2: 25,084,306 S368P probably benign Het
Epg5 A T 18: 78,023,990 Q2222L probably damaging Het
Ercc5 T A 1: 44,167,796 V623E probably benign Het
Flg2 A G 3: 93,202,999 E778G unknown Het
Gbe1 C T 16: 70,495,324 R515* probably null Het
Hsd17b6 A G 10: 127,994,327 probably null Het
Hyal6 C T 6: 24,734,032 probably benign Het
Ifi27l2b A G 12: 103,451,319 I203T probably damaging Het
Kcnk9 A C 15: 72,512,401 D309E unknown Het
Lrp6 C T 6: 134,464,451 R1184Q probably damaging Het
Mdn1 T C 4: 32,700,103 F1399L probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mx1 T C 16: 97,451,512 *289W probably null Het
Myo7b T C 18: 31,961,185 E1970G probably damaging Het
Mypn T C 10: 63,121,964 Y24C probably damaging Het
Naxe G C 3: 88,057,133 P167A probably benign Het
Nmnat2 A T 1: 153,112,440 K272* probably null Het
Nmnat3 C T 9: 98,354,111 T19M probably damaging Het
Olfr1275 T C 2: 111,231,698 I32V probably benign Het
Olfr1412 G A 1: 92,588,389 V20M probably benign Het
Olfr1474 A G 19: 13,471,362 T131A probably benign Het
Olfr64 A T 7: 103,893,555 F60Y probably damaging Het
Olfr66 A G 7: 103,881,592 V217A probably benign Het
Pgm3 T G 9: 86,556,204 E509D probably damaging Het
Phf3 A T 1: 30,811,942 D1110E probably damaging Het
Pkd1 T G 17: 24,581,569 S3062A probably benign Het
Pogz A T 3: 94,870,126 K372N possibly damaging Het
Pou1f1 A G 16: 65,523,470 Y15C probably benign Het
Ppfia2 A G 10: 106,896,507 T972A possibly damaging Het
Rasip1 A G 7: 45,635,318 Y703C possibly damaging Het
Recql T A 6: 142,364,598 Q502L probably benign Het
Rgs9 A T 11: 109,239,499 Y383* probably null Het
Rimbp3 T C 16: 17,212,632 S1307P probably benign Het
Rspo1 A G 4: 125,007,745 T200A probably damaging Het
Ryr3 C T 2: 112,867,292 M922I probably damaging Het
Samm50 C T 15: 84,211,127 A438V probably damaging Het
Sec1 A C 7: 45,678,832 S264A probably benign Het
Sec31a A T 5: 100,381,336 probably null Het
Slc13a3 T C 2: 165,406,699 N553S unknown Het
Smg6 T A 11: 74,946,116 L852Q probably damaging Het
Spata13 A G 14: 60,691,725 N244S probably damaging Het
Srbd1 T C 17: 86,057,685 R648G probably damaging Het
Sugct T G 13: 17,452,454 probably null Het
Tmed10 A G 12: 85,354,879 Y85H probably damaging Het
Trim68 A G 7: 102,684,073 I134T possibly damaging Het
Trio A G 15: 27,744,038 C2603R possibly damaging Het
Tspyl3 G A 2: 153,225,256 R21W probably damaging Het
Ttn T C 2: 76,810,699 I11863V probably null Het
Ubp1 G A 9: 113,964,579 A283T possibly damaging Het
Ubtf A T 11: 102,314,918 F60L probably damaging Het
Vmn1r235 T C 17: 21,261,737 I108T probably benign Het
Vmn2r125 T C 4: 156,351,373 S349P probably damaging Het
Vmn2r25 A G 6: 123,828,465 S478P probably damaging Het
Vmn2r88 T A 14: 51,418,572 V746D probably damaging Het
Zcwpw1 A G 5: 137,796,652 K37E probably damaging Het
Zdhhc24 T C 19: 4,883,766 S284P probably damaging Het
Zswim8 C A 14: 20,716,327 H841N probably damaging Het
Other mutations in Aff3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Aff3 APN 1 38535681 missense probably damaging 1.00
IGL02263:Aff3 APN 1 38535599 missense probably damaging 1.00
IGL02962:Aff3 APN 1 38535656 missense probably damaging 1.00
IGL03003:Aff3 APN 1 38209570 missense probably damaging 1.00
IGL03180:Aff3 APN 1 38535662 missense probably damaging 1.00
IGL03389:Aff3 APN 1 38210349 missense possibly damaging 0.62
R0004:Aff3 UTSW 1 38269726 missense possibly damaging 0.46
R0004:Aff3 UTSW 1 38269726 missense possibly damaging 0.46
R0026:Aff3 UTSW 1 38203893 missense probably benign 0.00
R0279:Aff3 UTSW 1 38535569 missense probably damaging 1.00
R0344:Aff3 UTSW 1 38203932 missense probably benign
R0375:Aff3 UTSW 1 38204940 missense possibly damaging 0.46
R0605:Aff3 UTSW 1 38209987 missense probably damaging 1.00
R0613:Aff3 UTSW 1 38209923 missense probably benign 0.09
R0742:Aff3 UTSW 1 38627108 missense probably damaging 0.99
R1156:Aff3 UTSW 1 38204910 missense probably benign
R1255:Aff3 UTSW 1 38204884 splice site probably null
R1448:Aff3 UTSW 1 38191283 missense probably damaging 1.00
R1760:Aff3 UTSW 1 38329864 splice site probably benign
R1855:Aff3 UTSW 1 38210304 missense probably benign 0.23
R2011:Aff3 UTSW 1 38207915 missense probably benign 0.01
R2331:Aff3 UTSW 1 38204890 splice site probably null
R2965:Aff3 UTSW 1 38209710 missense probably damaging 1.00
R2970:Aff3 UTSW 1 38535022 missense probably damaging 0.97
R3015:Aff3 UTSW 1 38210568 missense probably benign 0.00
R3763:Aff3 UTSW 1 38252689 splice site probably benign
R4174:Aff3 UTSW 1 38207927 missense probably damaging 0.96
R4436:Aff3 UTSW 1 38209687 missense possibly damaging 0.75
R4661:Aff3 UTSW 1 38627128 missense possibly damaging 0.94
R5069:Aff3 UTSW 1 38181613 critical splice donor site probably null
R5566:Aff3 UTSW 1 38181424 missense probably damaging 1.00
R6023:Aff3 UTSW 1 38218370 missense probably damaging 1.00
R6209:Aff3 UTSW 1 38193589 missense probably benign 0.28
R6467:Aff3 UTSW 1 38208017 missense probably benign 0.25
R6748:Aff3 UTSW 1 38535246 missense probably damaging 1.00
R6862:Aff3 UTSW 1 38406497 missense possibly damaging 0.87
R6880:Aff3 UTSW 1 38535162 missense probably damaging 0.99
R6880:Aff3 UTSW 1 38627128 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCGACTCTGCCCCAAAATGCTC -3'
(R):5'- TGGCCGTAGCACAAATACCAGTAAC -3'

Sequencing Primer
(F):5'- TCATCTATCTTGTTCACGGGAG -3'
(R):5'- CGGAGGCTAACAGCTATCTTCAG -3'
Posted On2014-05-23