Incidental Mutation 'R0083:Neu2'
ID19743
Institutional Source Beutler Lab
Gene Symbol Neu2
Ensembl Gene ENSMUSG00000079434
Gene Nameneuraminidase 2
SynonymsMSS, MTS, MBS, cystolic sialidase, brain sialidase
MMRRC Submission 038370-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0083 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location87509889-87597845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87597262 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 323 (Y323C)
Ref Sequence ENSEMBL: ENSMUSP00000131409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070898] [ENSMUST00000163606] [ENSMUST00000164128] [ENSMUST00000165109] [ENSMUST00000166055] [ENSMUST00000166259] [ENSMUST00000172222]
Predicted Effect probably damaging
Transcript: ENSMUST00000070898
AA Change: Y309C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065439
Gene: ENSMUSG00000079434
AA Change: Y309C

DomainStartEndE-ValueType
Pfam:BNR_2 32 345 4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163606
SMART Domains Protein: ENSMUSP00000127777
Gene: ENSMUSG00000079434

DomainStartEndE-ValueType
PDB:2F27|B 15 90 1e-31 PDB
SCOP:d1eur__ 19 90 1e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164128
AA Change: Y315C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127913
Gene: ENSMUSG00000079434
AA Change: Y315C

DomainStartEndE-ValueType
Pfam:BNR_2 38 351 1.3e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165109
AA Change: Y309C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126509
Gene: ENSMUSG00000079434
AA Change: Y309C

DomainStartEndE-ValueType
Pfam:BNR_2 32 345 4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166055
SMART Domains Protein: ENSMUSP00000132099
Gene: ENSMUSG00000079434

DomainStartEndE-ValueType
Pfam:BNR_2 32 110 8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166259
AA Change: Y309C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132513
Gene: ENSMUSG00000079434
AA Change: Y309C

DomainStartEndE-ValueType
Pfam:BNR_2 32 345 4e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172222
AA Change: Y323C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131409
Gene: ENSMUSG00000079434
AA Change: Y323C

DomainStartEndE-ValueType
Pfam:BNR_2 46 359 1.2e-43 PFAM
Meta Mutation Damage Score 0.402 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 83.1%
Validation Efficiency 88% (117/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a family of glycohydrolytic enzymes which remove sialic acid residues from glycoproteins and glycolipids. Expression studies in COS7 cells confirmed that this gene encodes a functional sialidase. Its cytosolic localization was demonstrated by cell fractionation experiments. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,494,132 F283L possibly damaging Het
4930562C15Rik A T 16: 4,849,542 I266F unknown Het
Adam39 T G 8: 40,825,078 F169V probably damaging Het
Adcy2 A T 13: 68,651,935 V858E probably damaging Het
Adgrv1 A G 13: 81,578,404 probably benign Het
Ankrd26 G T 6: 118,523,254 H1085Q probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atg4c C T 4: 99,221,440 H215Y possibly damaging Het
Atp6v0d2 G A 4: 19,880,001 probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
C1qtnf3 G A 15: 10,975,632 V175I possibly damaging Het
Cacna1c A G 6: 118,625,523 M1293T probably damaging Het
Ccdc88a T A 11: 29,503,463 S337T probably damaging Het
Cntn4 A G 6: 106,525,369 I362M possibly damaging Het
Col22a1 A T 15: 71,890,497 D104E possibly damaging Het
Col4a4 T C 1: 82,507,111 probably null Het
Cul7 C A 17: 46,655,556 R304S probably benign Het
Elfn2 A T 15: 78,673,414 L311Q probably damaging Het
Esrrb T C 12: 86,514,452 L320P probably damaging Het
Fbxw10 A G 11: 62,877,061 T903A probably benign Het
Fkbp4 G A 6: 128,432,407 probably benign Het
Gatad2b T A 3: 90,357,943 Y576N probably damaging Het
Greb1 T C 12: 16,696,451 M1273V probably benign Het
Helq C A 5: 100,768,368 E913* probably null Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Ints13 A G 6: 146,550,664 Y686H probably benign Het
Itgb7 C T 15: 102,223,482 R222H probably damaging Het
Krt81 A G 15: 101,463,465 I78T probably damaging Het
Lonp2 G A 8: 86,716,355 V815I probably benign Het
Mctp2 G T 7: 72,228,516 F271L possibly damaging Het
Mrto4 C T 4: 139,347,968 V175I possibly damaging Het
Myh14 A G 7: 44,634,519 V654A probably damaging Het
Nt5dc1 A C 10: 34,403,764 M94R probably damaging Het
Nup210l A G 3: 90,189,575 T1364A probably damaging Het
Obscn T C 11: 59,022,374 D6939G probably damaging Het
Olfr1491 A T 19: 13,705,678 T284S probably damaging Het
Pias4 A G 10: 81,164,166 S18P probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Plk5 G A 10: 80,356,662 G34S possibly damaging Het
Ptprj A T 2: 90,469,777 probably null Het
Rps6ka2 G A 17: 7,296,043 D617N probably benign Het
Sap130 C A 18: 31,666,329 probably benign Het
Sap130 C T 18: 31,711,641 P902S probably damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Sel1l3 C T 5: 53,137,902 A786T possibly damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc15a2 T C 16: 36,782,283 Y72C probably damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slc30a5 G T 13: 100,803,400 A669E probably damaging Het
Sppl2c G A 11: 104,186,532 V53I probably benign Het
Sstr1 T A 12: 58,213,742 C384S possibly damaging Het
Sulf1 A G 1: 12,817,417 M272V probably damaging Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Tmem94 A G 11: 115,796,724 probably benign Het
Topaz1 A T 9: 122,775,609 I1093L probably benign Het
Ttll4 G T 1: 74,679,769 V260L probably benign Het
Vmn2r26 A T 6: 124,053,981 probably null Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp939 A T 7: 39,474,110 noncoding transcript Het
Other mutations in Neu2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02476:Neu2 APN 1 87596952 missense probably damaging 1.00
IGL03143:Neu2 APN 1 87596976 nonsense probably null
R0097:Neu2 UTSW 1 87597466 missense probably benign
R0097:Neu2 UTSW 1 87597466 missense probably benign
R1109:Neu2 UTSW 1 87596728 missense probably damaging 1.00
R1921:Neu2 UTSW 1 87597301 missense probably benign 0.02
R2897:Neu2 UTSW 1 87595060 missense probably benign 0.01
R2898:Neu2 UTSW 1 87595060 missense probably benign 0.01
R5395:Neu2 UTSW 1 87596675 unclassified probably null
R5867:Neu2 UTSW 1 87596756 missense probably damaging 0.96
R5868:Neu2 UTSW 1 87596756 missense probably damaging 0.96
R6468:Neu2 UTSW 1 87596878 missense probably damaging 1.00
R6544:Neu2 UTSW 1 87596742 missense probably damaging 1.00
R6610:Neu2 UTSW 1 87596685 missense probably benign 0.01
R6831:Neu2 UTSW 1 87596733 missense probably damaging 1.00
R7151:Neu2 UTSW 1 87596575 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGGGCACACATGGAAACTAGGC -3'
(R):5'- CACTGGGCATCAAATACAGTGGGG -3'

Sequencing Primer
(F):5'- GCACAAAGTCCTAATGATGGTCTG -3'
(R):5'- AAAGCTTGCTTCAGGGTGAATATG -3'
Posted On2013-04-11