Incidental Mutation 'R1780:Recql'
ID197447
Institutional Source Beutler Lab
Gene Symbol Recql
Ensembl Gene ENSMUSG00000030243
Gene NameRecQ protein-like
SynonymsRecQ1
MMRRC Submission 039811-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R1780 (G1)
Quality Score212
Status Validated
Chromosome6
Chromosomal Location142350342-142387087 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 142364598 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 502 (Q502L)
Ref Sequence ENSEMBL: ENSMUSP00000107434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032370] [ENSMUST00000041852] [ENSMUST00000100832] [ENSMUST00000111803]
Predicted Effect probably benign
Transcript: ENSMUST00000032370
AA Change: Q502L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032370
Gene: ENSMUSG00000030243
AA Change: Q502L

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 2.5e-27 SMART
HELICc 328 409 2.2e-26 SMART
Pfam:RQC 488 592 5.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041852
SMART Domains Protein: ENSMUSP00000036394
Gene: ENSMUSG00000041671

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 8 234 2.2e-18 PFAM
Pfam:Pyr_redox_2 266 381 4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100832
AA Change: Q502L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098394
Gene: ENSMUSG00000030243
AA Change: Q502L

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 6e-25 SMART
HELICc 328 409 5.51e-24 SMART
Pfam:RQC 488 592 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111803
AA Change: Q502L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107434
Gene: ENSMUSG00000030243
AA Change: Q502L

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 6e-25 SMART
HELICc 328 409 5.51e-24 SMART
Pfam:RecQ_Zn_bind 420 479 2.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138578
Predicted Effect unknown
Transcript: ENSMUST00000141504
AA Change: Q91L
SMART Domains Protein: ENSMUSP00000119452
Gene: ENSMUSG00000030243
AA Change: Q91L

DomainStartEndE-ValueType
Pfam:RecQ_Zn_bind 10 69 7.1e-16 PFAM
Pfam:RQC 73 187 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155149
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RecQ DNA helicase family. DNA helicases are enzymes involved in various types of DNA repair, including mismatch repair, nucleotide excision repair and direct repair. The encoded protein is involved in the processing of Holliday junctions, the suppression of sister chromatid exchanges, telomere maintenance, and is required for genotoxic stress resistance. Defects in this gene have been associated with several types of cancer. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutation of this gene results in chromosomal instability, with embryonic fibroblasts exhibiting aneuploidy, spontaneous chromosomal breakage, frequent translocation events, increased sensitivity to ionizing radiation, and increased frequency of sister chromatid exchange. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,852,593 E493G probably damaging Het
Aff3 A T 1: 38,535,702 S66T probably damaging Het
Ankrd17 T A 5: 90,232,415 K2470N probably damaging Het
Ap3m1 T C 14: 21,041,070 T156A probably benign Het
Arhgef4 T A 1: 34,724,160 S832R possibly damaging Het
Asb10 T C 5: 24,533,676 D423G possibly damaging Het
Ash1l A G 3: 88,965,984 T25A probably benign Het
Atp13a2 T A 4: 141,002,460 L663I possibly damaging Het
Atp9b A T 18: 80,776,897 Y174* probably null Het
Bche A G 3: 73,700,620 I491T probably benign Het
Bckdhb T C 9: 83,953,783 probably null Het
Cadps2 C T 6: 23,320,932 probably null Het
Cdc42bpb A T 12: 111,322,907 V468E probably damaging Het
Chrnd T C 1: 87,192,548 V33A possibly damaging Het
Col6a5 A T 9: 105,936,878 V645D unknown Het
Cpa1 C T 6: 30,643,008 L312F probably damaging Het
Cyp2a5 A G 7: 26,841,876 probably benign Het
Cyp2c39 C A 19: 39,538,851 probably benign Het
Cyp2d26 T C 15: 82,794,007 N56S probably damaging Het
Ddx21 A G 10: 62,594,147 probably benign Het
Dnah11 A T 12: 118,027,558 C2358S probably damaging Het
Entpd8 T C 2: 25,084,306 S368P probably benign Het
Epg5 A T 18: 78,023,990 Q2222L probably damaging Het
Ercc5 T A 1: 44,167,796 V623E probably benign Het
Flg2 A G 3: 93,202,999 E778G unknown Het
Gbe1 C T 16: 70,495,324 R515* probably null Het
Hsd17b6 A G 10: 127,994,327 probably null Het
Hyal6 C T 6: 24,734,032 probably benign Het
Ifi27l2b A G 12: 103,451,319 I203T probably damaging Het
Kcnk9 A C 15: 72,512,401 D309E unknown Het
Lrp6 C T 6: 134,464,451 R1184Q probably damaging Het
Mdn1 T C 4: 32,700,103 F1399L probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mx1 T C 16: 97,451,512 *289W probably null Het
Myo7b T C 18: 31,961,185 E1970G probably damaging Het
Mypn T C 10: 63,121,964 Y24C probably damaging Het
Naxe G C 3: 88,057,133 P167A probably benign Het
Nmnat2 A T 1: 153,112,440 K272* probably null Het
Nmnat3 C T 9: 98,354,111 T19M probably damaging Het
Olfr1275 T C 2: 111,231,698 I32V probably benign Het
Olfr1412 G A 1: 92,588,389 V20M probably benign Het
Olfr1474 A G 19: 13,471,362 T131A probably benign Het
Olfr64 A T 7: 103,893,555 F60Y probably damaging Het
Olfr66 A G 7: 103,881,592 V217A probably benign Het
Pgm3 T G 9: 86,556,204 E509D probably damaging Het
Phf3 A T 1: 30,811,942 D1110E probably damaging Het
Pkd1 T G 17: 24,581,569 S3062A probably benign Het
Pogz A T 3: 94,870,126 K372N possibly damaging Het
Pou1f1 A G 16: 65,523,470 Y15C probably benign Het
Ppfia2 A G 10: 106,896,507 T972A possibly damaging Het
Rasip1 A G 7: 45,635,318 Y703C possibly damaging Het
Rgs9 A T 11: 109,239,499 Y383* probably null Het
Rimbp3 T C 16: 17,212,632 S1307P probably benign Het
Rspo1 A G 4: 125,007,745 T200A probably damaging Het
Ryr3 C T 2: 112,867,292 M922I probably damaging Het
Samm50 C T 15: 84,211,127 A438V probably damaging Het
Sec1 A C 7: 45,678,832 S264A probably benign Het
Sec31a A T 5: 100,381,336 probably null Het
Slc13a3 T C 2: 165,406,699 N553S unknown Het
Smg6 T A 11: 74,946,116 L852Q probably damaging Het
Spata13 A G 14: 60,691,725 N244S probably damaging Het
Srbd1 T C 17: 86,057,685 R648G probably damaging Het
Sugct T G 13: 17,452,454 probably null Het
Tmed10 A G 12: 85,354,879 Y85H probably damaging Het
Trim68 A G 7: 102,684,073 I134T possibly damaging Het
Trio A G 15: 27,744,038 C2603R possibly damaging Het
Tspyl3 G A 2: 153,225,256 R21W probably damaging Het
Ttn T C 2: 76,810,699 I11863V probably null Het
Ubp1 G A 9: 113,964,579 A283T possibly damaging Het
Ubtf A T 11: 102,314,918 F60L probably damaging Het
Vmn1r235 T C 17: 21,261,737 I108T probably benign Het
Vmn2r125 T C 4: 156,351,373 S349P probably damaging Het
Vmn2r25 A G 6: 123,828,465 S478P probably damaging Het
Vmn2r88 T A 14: 51,418,572 V746D probably damaging Het
Zcwpw1 A G 5: 137,796,652 K37E probably damaging Het
Zdhhc24 T C 19: 4,883,766 S284P probably damaging Het
Zswim8 C A 14: 20,716,327 H841N probably damaging Het
Other mutations in Recql
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Recql APN 6 142376921 missense probably null 0.34
IGL01933:Recql APN 6 142364638 missense probably benign 0.33
IGL02026:Recql APN 6 142366668 nonsense probably null
IGL03181:Recql APN 6 142378192 missense probably benign 0.00
K3955:Recql UTSW 6 142378206 nonsense probably null
R0380:Recql UTSW 6 142369430 missense probably damaging 1.00
R1371:Recql UTSW 6 142372875 missense probably damaging 0.99
R1742:Recql UTSW 6 142364572 missense probably damaging 1.00
R1921:Recql UTSW 6 142365589 missense probably benign 0.41
R2032:Recql UTSW 6 142367283 missense probably damaging 1.00
R2966:Recql UTSW 6 142363587 missense probably benign 0.10
R4666:Recql UTSW 6 142376841 missense probably damaging 1.00
R4779:Recql UTSW 6 142363700 intron probably benign
R4863:Recql UTSW 6 142359006 utr 3 prime probably benign
R5115:Recql UTSW 6 142358559 utr 3 prime probably benign
R5400:Recql UTSW 6 142362347 intron probably benign
R5781:Recql UTSW 6 142365618 splice site probably null
R5981:Recql UTSW 6 142372878 missense probably damaging 1.00
R6372:Recql UTSW 6 142376840 missense probably damaging 1.00
R6651:Recql UTSW 6 142364434 critical splice donor site probably null
R6786:Recql UTSW 6 142364552 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ACGGGCTGTGTACTTGAGATATTGC -3'
(R):5'- AGCTGACGTGAATCCAGTGTGTAAG -3'

Sequencing Primer
(F):5'- AGCCACTCTCAACTTGGCT -3'
(R):5'- AGCCCAGACTGGCTTTCATAG -3'
Posted On2014-05-23