Incidental Mutation 'R0083:Gatad2b'
ID19746
Institutional Source Beutler Lab
Gene Symbol Gatad2b
Ensembl Gene ENSMUSG00000042390
Gene NameGATA zinc finger domain containing 2B
Synonymsp66beta, C430014D17Rik
MMRRC Submission 038370-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0083 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90293178-90363407 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90357943 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 576 (Y576N)
Ref Sequence ENSEMBL: ENSMUSP00000142514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049382] [ENSMUST00000197988] [ENSMUST00000199607] [ENSMUST00000199754]
Predicted Effect probably damaging
Transcript: ENSMUST00000049382
AA Change: Y576N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041370
Gene: ENSMUSG00000042390
AA Change: Y576N

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
Pfam:P66_CC 158 201 1.7e-21 PFAM
low complexity region 341 361 N/A INTRINSIC
low complexity region 365 382 N/A INTRINSIC
Pfam:GATA 421 455 1e-11 PFAM
coiled coil region 456 478 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196212
Predicted Effect probably damaging
Transcript: ENSMUST00000197988
AA Change: Y560N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143085
Gene: ENSMUSG00000042390
AA Change: Y560N

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
coiled coil region 158 194 N/A INTRINSIC
low complexity region 325 345 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
Pfam:GATA 405 439 9.3e-11 PFAM
coiled coil region 440 462 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199607
AA Change: Y576N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142617
Gene: ENSMUSG00000042390
AA Change: Y576N

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
coiled coil region 158 194 N/A INTRINSIC
low complexity region 341 361 N/A INTRINSIC
low complexity region 365 382 N/A INTRINSIC
Pfam:GATA 421 455 7.8e-11 PFAM
coiled coil region 456 478 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199754
AA Change: Y576N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142514
Gene: ENSMUSG00000042390
AA Change: Y576N

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
coiled coil region 158 194 N/A INTRINSIC
low complexity region 341 361 N/A INTRINSIC
low complexity region 365 382 N/A INTRINSIC
Pfam:GATA 421 455 7.8e-11 PFAM
coiled coil region 456 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206907
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 83.1%
Validation Efficiency 88% (117/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein transcriptional repressor. The encoded protein is part of the methyl-CpG-binding protein-1 complex, which represses gene expression by deacetylating methylated nucleosomes. Mutations in this gene are linked to intellectual disability and dysmorphic features associated with mental retardation. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,494,132 F283L possibly damaging Het
4930562C15Rik A T 16: 4,849,542 I266F unknown Het
Adam39 T G 8: 40,825,078 F169V probably damaging Het
Adcy2 A T 13: 68,651,935 V858E probably damaging Het
Adgrv1 A G 13: 81,578,404 probably benign Het
Ankrd26 G T 6: 118,523,254 H1085Q probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atg4c C T 4: 99,221,440 H215Y possibly damaging Het
Atp6v0d2 G A 4: 19,880,001 probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
C1qtnf3 G A 15: 10,975,632 V175I possibly damaging Het
Cacna1c A G 6: 118,625,523 M1293T probably damaging Het
Ccdc88a T A 11: 29,503,463 S337T probably damaging Het
Cntn4 A G 6: 106,525,369 I362M possibly damaging Het
Col22a1 A T 15: 71,890,497 D104E possibly damaging Het
Col4a4 T C 1: 82,507,111 probably null Het
Cul7 C A 17: 46,655,556 R304S probably benign Het
Elfn2 A T 15: 78,673,414 L311Q probably damaging Het
Esrrb T C 12: 86,514,452 L320P probably damaging Het
Fbxw10 A G 11: 62,877,061 T903A probably benign Het
Fkbp4 G A 6: 128,432,407 probably benign Het
Greb1 T C 12: 16,696,451 M1273V probably benign Het
Helq C A 5: 100,768,368 E913* probably null Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Ints13 A G 6: 146,550,664 Y686H probably benign Het
Itgb7 C T 15: 102,223,482 R222H probably damaging Het
Krt81 A G 15: 101,463,465 I78T probably damaging Het
Lonp2 G A 8: 86,716,355 V815I probably benign Het
Mctp2 G T 7: 72,228,516 F271L possibly damaging Het
Mrto4 C T 4: 139,347,968 V175I possibly damaging Het
Myh14 A G 7: 44,634,519 V654A probably damaging Het
Neu2 A G 1: 87,597,262 Y323C probably damaging Het
Nt5dc1 A C 10: 34,403,764 M94R probably damaging Het
Nup210l A G 3: 90,189,575 T1364A probably damaging Het
Obscn T C 11: 59,022,374 D6939G probably damaging Het
Olfr1491 A T 19: 13,705,678 T284S probably damaging Het
Pias4 A G 10: 81,164,166 S18P probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Plk5 G A 10: 80,356,662 G34S possibly damaging Het
Ptprj A T 2: 90,469,777 probably null Het
Rps6ka2 G A 17: 7,296,043 D617N probably benign Het
Sap130 C A 18: 31,666,329 probably benign Het
Sap130 C T 18: 31,711,641 P902S probably damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Sel1l3 C T 5: 53,137,902 A786T possibly damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc15a2 T C 16: 36,782,283 Y72C probably damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slc30a5 G T 13: 100,803,400 A669E probably damaging Het
Sppl2c G A 11: 104,186,532 V53I probably benign Het
Sstr1 T A 12: 58,213,742 C384S possibly damaging Het
Sulf1 A G 1: 12,817,417 M272V probably damaging Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Tmem94 A G 11: 115,796,724 probably benign Het
Topaz1 A T 9: 122,775,609 I1093L probably benign Het
Ttll4 G T 1: 74,679,769 V260L probably benign Het
Vmn2r26 A T 6: 124,053,981 probably null Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp939 A T 7: 39,474,110 noncoding transcript Het
Other mutations in Gatad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Gatad2b APN 3 90352078 missense possibly damaging 0.93
IGL02172:Gatad2b APN 3 90355671 splice site probably benign
IGL02672:Gatad2b APN 3 90341891 missense possibly damaging 0.77
IGL03030:Gatad2b APN 3 90341937 missense probably benign 0.11
FR4449:Gatad2b UTSW 3 90341917 small deletion probably benign
R0108:Gatad2b UTSW 3 90357943 missense probably damaging 1.00
R0335:Gatad2b UTSW 3 90356182 missense probably benign 0.00
R0707:Gatad2b UTSW 3 90356182 missense probably benign 0.00
R1722:Gatad2b UTSW 3 90355679 missense probably damaging 1.00
R1782:Gatad2b UTSW 3 90341871 missense probably benign 0.01
R2138:Gatad2b UTSW 3 90352113 missense probably damaging 1.00
R5954:Gatad2b UTSW 3 90351441 missense probably damaging 1.00
R6834:Gatad2b UTSW 3 90348643 missense probably benign 0.00
R7104:Gatad2b UTSW 3 90351417 missense probably damaging 1.00
R7190:Gatad2b UTSW 3 90350415 missense probably benign 0.01
R7291:Gatad2b UTSW 3 90351414 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGGAGGACTCTTTCCCTGAAGC -3'
(R):5'- TATGGTAGGCACCAGTACAGGCAC -3'

Sequencing Primer
(F):5'- CTTTCCCTGAAGCTCAGGAGTAAG -3'
(R):5'- ACAAGTGGAACAGGCGTT -3'
Posted On2013-04-11