Incidental Mutation 'R1780:Ddx21'
ID197461
Institutional Source Beutler Lab
Gene Symbol Ddx21
Ensembl Gene ENSMUSG00000020075
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 21
SynonymsD10Wsu42e, RH II/Gu, D10Ertd645e, RH-II/Gualpha
MMRRC Submission 039811-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1780 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62580251-62602281 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 62594147 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045866]
PDB Structure
Gu_alpha_helicase [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000045866
SMART Domains Protein: ENSMUSP00000042691
Gene: ENSMUSG00000020075

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
low complexity region 107 139 N/A INTRINSIC
internal_repeat_1 140 160 2.96e-8 PROSPERO
low complexity region 162 171 N/A INTRINSIC
low complexity region 199 208 N/A INTRINSIC
internal_repeat_1 214 234 2.96e-8 PROSPERO
DEXDc 277 484 2.76e-56 SMART
HELICc 524 604 1.55e-27 SMART
low complexity region 682 688 N/A INTRINSIC
Pfam:GUCT 692 787 1.6e-33 PFAM
low complexity region 827 843 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220060
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is an antigen recognized by autoimmune antibodies from a patient with watermelon stomach disease. This protein unwinds double-stranded RNA, folds single-stranded RNA, and may play important roles in ribosomal RNA biogenesis, RNA editing, RNA transport, and general transcription. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,852,593 E493G probably damaging Het
Aff3 A T 1: 38,535,702 S66T probably damaging Het
Ankrd17 T A 5: 90,232,415 K2470N probably damaging Het
Ap3m1 T C 14: 21,041,070 T156A probably benign Het
Arhgef4 T A 1: 34,724,160 S832R possibly damaging Het
Asb10 T C 5: 24,533,676 D423G possibly damaging Het
Ash1l A G 3: 88,965,984 T25A probably benign Het
Atp13a2 T A 4: 141,002,460 L663I possibly damaging Het
Atp9b A T 18: 80,776,897 Y174* probably null Het
Bche A G 3: 73,700,620 I491T probably benign Het
Bckdhb T C 9: 83,953,783 probably null Het
Cadps2 C T 6: 23,320,932 probably null Het
Cdc42bpb A T 12: 111,322,907 V468E probably damaging Het
Chrnd T C 1: 87,192,548 V33A possibly damaging Het
Col6a5 A T 9: 105,936,878 V645D unknown Het
Cpa1 C T 6: 30,643,008 L312F probably damaging Het
Cyp2a5 A G 7: 26,841,876 probably benign Het
Cyp2c39 C A 19: 39,538,851 probably benign Het
Cyp2d26 T C 15: 82,794,007 N56S probably damaging Het
Dnah11 A T 12: 118,027,558 C2358S probably damaging Het
Entpd8 T C 2: 25,084,306 S368P probably benign Het
Epg5 A T 18: 78,023,990 Q2222L probably damaging Het
Ercc5 T A 1: 44,167,796 V623E probably benign Het
Flg2 A G 3: 93,202,999 E778G unknown Het
Gbe1 C T 16: 70,495,324 R515* probably null Het
Hsd17b6 A G 10: 127,994,327 probably null Het
Hyal6 C T 6: 24,734,032 probably benign Het
Ifi27l2b A G 12: 103,451,319 I203T probably damaging Het
Kcnk9 A C 15: 72,512,401 D309E unknown Het
Lrp6 C T 6: 134,464,451 R1184Q probably damaging Het
Mdn1 T C 4: 32,700,103 F1399L probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mx1 T C 16: 97,451,512 *289W probably null Het
Myo7b T C 18: 31,961,185 E1970G probably damaging Het
Mypn T C 10: 63,121,964 Y24C probably damaging Het
Naxe G C 3: 88,057,133 P167A probably benign Het
Nmnat2 A T 1: 153,112,440 K272* probably null Het
Nmnat3 C T 9: 98,354,111 T19M probably damaging Het
Olfr1275 T C 2: 111,231,698 I32V probably benign Het
Olfr1412 G A 1: 92,588,389 V20M probably benign Het
Olfr1474 A G 19: 13,471,362 T131A probably benign Het
Olfr64 A T 7: 103,893,555 F60Y probably damaging Het
Olfr66 A G 7: 103,881,592 V217A probably benign Het
Pgm3 T G 9: 86,556,204 E509D probably damaging Het
Phf3 A T 1: 30,811,942 D1110E probably damaging Het
Pkd1 T G 17: 24,581,569 S3062A probably benign Het
Pogz A T 3: 94,870,126 K372N possibly damaging Het
Pou1f1 A G 16: 65,523,470 Y15C probably benign Het
Ppfia2 A G 10: 106,896,507 T972A possibly damaging Het
Rasip1 A G 7: 45,635,318 Y703C possibly damaging Het
Recql T A 6: 142,364,598 Q502L probably benign Het
Rgs9 A T 11: 109,239,499 Y383* probably null Het
Rimbp3 T C 16: 17,212,632 S1307P probably benign Het
Rspo1 A G 4: 125,007,745 T200A probably damaging Het
Ryr3 C T 2: 112,867,292 M922I probably damaging Het
Samm50 C T 15: 84,211,127 A438V probably damaging Het
Sec1 A C 7: 45,678,832 S264A probably benign Het
Sec31a A T 5: 100,381,336 probably null Het
Slc13a3 T C 2: 165,406,699 N553S unknown Het
Smg6 T A 11: 74,946,116 L852Q probably damaging Het
Spata13 A G 14: 60,691,725 N244S probably damaging Het
Srbd1 T C 17: 86,057,685 R648G probably damaging Het
Sugct T G 13: 17,452,454 probably null Het
Tmed10 A G 12: 85,354,879 Y85H probably damaging Het
Trim68 A G 7: 102,684,073 I134T possibly damaging Het
Trio A G 15: 27,744,038 C2603R possibly damaging Het
Tspyl3 G A 2: 153,225,256 R21W probably damaging Het
Ttn T C 2: 76,810,699 I11863V probably null Het
Ubp1 G A 9: 113,964,579 A283T possibly damaging Het
Ubtf A T 11: 102,314,918 F60L probably damaging Het
Vmn1r235 T C 17: 21,261,737 I108T probably benign Het
Vmn2r125 T C 4: 156,351,373 S349P probably damaging Het
Vmn2r25 A G 6: 123,828,465 S478P probably damaging Het
Vmn2r88 T A 14: 51,418,572 V746D probably damaging Het
Zcwpw1 A G 5: 137,796,652 K37E probably damaging Het
Zdhhc24 T C 19: 4,883,766 S284P probably damaging Het
Zswim8 C A 14: 20,716,327 H841N probably damaging Het
Other mutations in Ddx21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00709:Ddx21 APN 10 62598402 nonsense probably null
IGL01144:Ddx21 APN 10 62598550 missense unknown
IGL01655:Ddx21 APN 10 62587491 missense probably damaging 0.98
IGL01694:Ddx21 APN 10 62598651 nonsense probably null
IGL01752:Ddx21 APN 10 62587507 missense probably damaging 1.00
IGL02827:Ddx21 APN 10 62598374 missense probably benign 0.04
IGL03140:Ddx21 APN 10 62594071 missense probably damaging 1.00
IGL03248:Ddx21 APN 10 62591990 missense possibly damaging 0.87
R0131:Ddx21 UTSW 10 62584752 missense possibly damaging 0.96
R0555:Ddx21 UTSW 10 62587528 missense probably damaging 1.00
R1437:Ddx21 UTSW 10 62598590 missense unknown
R1875:Ddx21 UTSW 10 62594068 missense probably damaging 1.00
R2696:Ddx21 UTSW 10 62594092 missense possibly damaging 0.93
R4639:Ddx21 UTSW 10 62591837 nonsense probably null
R4678:Ddx21 UTSW 10 62594003 missense probably benign 0.06
R4767:Ddx21 UTSW 10 62591972 missense probably damaging 1.00
R4799:Ddx21 UTSW 10 62588121 missense probably damaging 0.98
R5145:Ddx21 UTSW 10 62587539 critical splice acceptor site probably null
R5243:Ddx21 UTSW 10 62602213 start codon destroyed probably null 0.02
R6085:Ddx21 UTSW 10 62594087 missense probably damaging 1.00
R6701:Ddx21 UTSW 10 62590691 missense probably damaging 1.00
R7134:Ddx21 UTSW 10 62591855 missense not run
Predicted Primers PCR Primer
(F):5'- CCTCTCTTGTAGCCCACCTTGAAGT -3'
(R):5'- CCCTGGCACAGCACGGTATTAAA -3'

Sequencing Primer
(F):5'- AGTTTCTCAATTAAAGGGATGGC -3'
(R):5'- agttcaattcccagcaccc -3'
Posted On2014-05-23