Incidental Mutation 'R1780:Smg6'
ID197465
Institutional Source Beutler Lab
Gene Symbol Smg6
Ensembl Gene ENSMUSG00000038290
Gene NameSmg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms
MMRRC Submission 039811-MU
Accession Numbers

Genbank: NM_001002764.1; Ensembl: ENSMUST00000045281

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1780 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74925823-75164448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74946116 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 852 (L852Q)
Ref Sequence ENSEMBL: ENSMUSP00000043555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045281]
Predicted Effect probably damaging
Transcript: ENSMUST00000045281
AA Change: L852Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043555
Gene: ENSMUSG00000038290
AA Change: L852Q

DomainStartEndE-ValueType
internal_repeat_1 42 99 7.68e-6 PROSPERO
internal_repeat_1 135 188 7.68e-6 PROSPERO
low complexity region 212 227 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 417 426 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
coiled coil region 574 600 N/A INTRINSIC
Pfam:EST1 637 742 1.8e-18 PFAM
Pfam:EST1_DNA_bind 750 1106 1.6e-78 PFAM
coiled coil region 1197 1234 N/A INTRINSIC
PINc 1245 1396 2.85e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000130145
AA Change: L313Q
SMART Domains Protein: ENSMUSP00000120229
Gene: ENSMUSG00000038290
AA Change: L313Q

DomainStartEndE-ValueType
coiled coil region 35 61 N/A INTRINSIC
Pfam:EST1 99 204 1.3e-19 PFAM
Pfam:EST1_DNA_bind 212 339 7.3e-37 PFAM
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the telomerase ribonucleoprotein complex responsible for the replication and maintenance of chromosome ends. The encoded protein also plays a role in the nonsense-mediated mRNA decay (NMD) pathway, providing the endonuclease activity near the premature translation termination codon that is needed to initiate NMD. Alternatively spliced transcript variants encoding distinct protein isoforms have been described. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygosity for insertion of a transgene into intron 6 of the gene results in embryonic lethality. Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice homozygous for a conditional allele activated in embryonic stem cells exhibit defective telomere maintenance and NMD. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Gene trapped(52)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,852,593 E493G probably damaging Het
Aff3 A T 1: 38,535,702 S66T probably damaging Het
Ankrd17 T A 5: 90,232,415 K2470N probably damaging Het
Ap3m1 T C 14: 21,041,070 T156A probably benign Het
Arhgef4 T A 1: 34,724,160 S832R possibly damaging Het
Asb10 T C 5: 24,533,676 D423G possibly damaging Het
Ash1l A G 3: 88,965,984 T25A probably benign Het
Atp13a2 T A 4: 141,002,460 L663I possibly damaging Het
Atp9b A T 18: 80,776,897 Y174* probably null Het
Bche A G 3: 73,700,620 I491T probably benign Het
Bckdhb T C 9: 83,953,783 probably null Het
Cadps2 C T 6: 23,320,932 probably null Het
Cdc42bpb A T 12: 111,322,907 V468E probably damaging Het
Chrnd T C 1: 87,192,548 V33A possibly damaging Het
Col6a5 A T 9: 105,936,878 V645D unknown Het
Cpa1 C T 6: 30,643,008 L312F probably damaging Het
Cyp2a5 A G 7: 26,841,876 probably benign Het
Cyp2c39 C A 19: 39,538,851 probably benign Het
Cyp2d26 T C 15: 82,794,007 N56S probably damaging Het
Ddx21 A G 10: 62,594,147 probably benign Het
Dnah11 A T 12: 118,027,558 C2358S probably damaging Het
Entpd8 T C 2: 25,084,306 S368P probably benign Het
Epg5 A T 18: 78,023,990 Q2222L probably damaging Het
Ercc5 T A 1: 44,167,796 V623E probably benign Het
Flg2 A G 3: 93,202,999 E778G unknown Het
Gbe1 C T 16: 70,495,324 R515* probably null Het
Hsd17b6 A G 10: 127,994,327 probably null Het
Hyal6 C T 6: 24,734,032 probably benign Het
Ifi27l2b A G 12: 103,451,319 I203T probably damaging Het
Kcnk9 A C 15: 72,512,401 D309E unknown Het
Lrp6 C T 6: 134,464,451 R1184Q probably damaging Het
Mdn1 T C 4: 32,700,103 F1399L probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mx1 T C 16: 97,451,512 *289W probably null Het
Myo7b T C 18: 31,961,185 E1970G probably damaging Het
Mypn T C 10: 63,121,964 Y24C probably damaging Het
Naxe G C 3: 88,057,133 P167A probably benign Het
Nmnat2 A T 1: 153,112,440 K272* probably null Het
Nmnat3 C T 9: 98,354,111 T19M probably damaging Het
Olfr1275 T C 2: 111,231,698 I32V probably benign Het
Olfr1412 G A 1: 92,588,389 V20M probably benign Het
Olfr1474 A G 19: 13,471,362 T131A probably benign Het
Olfr64 A T 7: 103,893,555 F60Y probably damaging Het
Olfr66 A G 7: 103,881,592 V217A probably benign Het
Pgm3 T G 9: 86,556,204 E509D probably damaging Het
Phf3 A T 1: 30,811,942 D1110E probably damaging Het
Pkd1 T G 17: 24,581,569 S3062A probably benign Het
Pogz A T 3: 94,870,126 K372N possibly damaging Het
Pou1f1 A G 16: 65,523,470 Y15C probably benign Het
Ppfia2 A G 10: 106,896,507 T972A possibly damaging Het
Rasip1 A G 7: 45,635,318 Y703C possibly damaging Het
Recql T A 6: 142,364,598 Q502L probably benign Het
Rgs9 A T 11: 109,239,499 Y383* probably null Het
Rimbp3 T C 16: 17,212,632 S1307P probably benign Het
Rspo1 A G 4: 125,007,745 T200A probably damaging Het
Ryr3 C T 2: 112,867,292 M922I probably damaging Het
Samm50 C T 15: 84,211,127 A438V probably damaging Het
Sec1 A C 7: 45,678,832 S264A probably benign Het
Sec31a A T 5: 100,381,336 probably null Het
Slc13a3 T C 2: 165,406,699 N553S unknown Het
Spata13 A G 14: 60,691,725 N244S probably damaging Het
Srbd1 T C 17: 86,057,685 R648G probably damaging Het
Sugct T G 13: 17,452,454 probably null Het
Tmed10 A G 12: 85,354,879 Y85H probably damaging Het
Trim68 A G 7: 102,684,073 I134T possibly damaging Het
Trio A G 15: 27,744,038 C2603R possibly damaging Het
Tspyl3 G A 2: 153,225,256 R21W probably damaging Het
Ttn T C 2: 76,810,699 I11863V probably null Het
Ubp1 G A 9: 113,964,579 A283T possibly damaging Het
Ubtf A T 11: 102,314,918 F60L probably damaging Het
Vmn1r235 T C 17: 21,261,737 I108T probably benign Het
Vmn2r125 T C 4: 156,351,373 S349P probably damaging Het
Vmn2r25 A G 6: 123,828,465 S478P probably damaging Het
Vmn2r88 T A 14: 51,418,572 V746D probably damaging Het
Zcwpw1 A G 5: 137,796,652 K37E probably damaging Het
Zdhhc24 T C 19: 4,883,766 S284P probably damaging Het
Zswim8 C A 14: 20,716,327 H841N probably damaging Het
Other mutations in Smg6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Smg6 APN 11 74929148 missense probably benign
IGL01146:Smg6 APN 11 74930428 nonsense probably null
IGL01505:Smg6 APN 11 75156291 missense probably damaging 1.00
IGL01541:Smg6 APN 11 74925944 missense probably benign 0.43
IGL01636:Smg6 APN 11 74935103 critical splice donor site probably null
IGL02379:Smg6 APN 11 75053925 missense probably damaging 1.00
IGL02794:Smg6 APN 11 75053934 missense probably damaging 0.99
IGL02964:Smg6 APN 11 74930750 critical splice donor site probably null
IGL03057:Smg6 APN 11 74935434 nonsense probably null
1mM(1):Smg6 UTSW 11 74934989 splice site probably benign
IGL03097:Smg6 UTSW 11 74932426 missense probably damaging 1.00
R0269:Smg6 UTSW 11 75162931 missense probably benign
R0344:Smg6 UTSW 11 74929821 missense probably damaging 1.00
R0437:Smg6 UTSW 11 74929701 missense probably damaging 1.00
R0452:Smg6 UTSW 11 74930213 missense probably benign
R0511:Smg6 UTSW 11 74929058 missense probably damaging 1.00
R0617:Smg6 UTSW 11 75162931 missense probably benign
R0737:Smg6 UTSW 11 75159836 missense probably damaging 1.00
R1715:Smg6 UTSW 11 74929430 missense probably benign
R1927:Smg6 UTSW 11 75142848 missense probably damaging 1.00
R2073:Smg6 UTSW 11 74930294 missense probably damaging 1.00
R2171:Smg6 UTSW 11 75038646 missense probably damaging 1.00
R2513:Smg6 UTSW 11 74929676 missense probably damaging 1.00
R3943:Smg6 UTSW 11 74929541 missense probably damaging 1.00
R3944:Smg6 UTSW 11 74929541 missense probably damaging 1.00
R4275:Smg6 UTSW 11 74993874 intron probably benign
R4369:Smg6 UTSW 11 74932443 nonsense probably null
R4452:Smg6 UTSW 11 74990141 missense probably benign 0.14
R4864:Smg6 UTSW 11 74930162 missense possibly damaging 0.89
R4885:Smg6 UTSW 11 75041918 missense probably damaging 1.00
R5043:Smg6 UTSW 11 74929895 missense possibly damaging 0.86
R5189:Smg6 UTSW 11 75041996 missense probably damaging 1.00
R5378:Smg6 UTSW 11 75041994 missense possibly damaging 0.61
R5518:Smg6 UTSW 11 75053898 missense probably damaging 0.99
R5725:Smg6 UTSW 11 74930613 missense probably benign 0.45
R5746:Smg6 UTSW 11 75139287 missense probably damaging 1.00
R6151:Smg6 UTSW 11 75156207 missense probably damaging 0.96
R6319:Smg6 UTSW 11 75156222 missense probably damaging 1.00
R6349:Smg6 UTSW 11 75053774 missense possibly damaging 0.94
R6500:Smg6 UTSW 11 74930505 missense possibly damaging 0.74
R6619:Smg6 UTSW 11 74932453 critical splice donor site probably null
R6820:Smg6 UTSW 11 75041964 missense probably damaging 0.99
R6923:Smg6 UTSW 11 74929343 missense possibly damaging 0.50
X0018:Smg6 UTSW 11 74929986 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TAGAGCGTACCTGTTCCACAGCAC -3'
(R):5'- CTTAAAGCTGGGACCTGTCTATGCC -3'

Sequencing Primer
(F):5'- GCTACTTTGGTACTGTAGCAGAATC -3'
(R):5'- GGACCTGTCTATGCCTCAGC -3'
Posted On2014-05-23