Incidental Mutation 'R1780:Pkd1'
ID197488
Institutional Source Beutler Lab
Gene Symbol Pkd1
Ensembl Gene ENSMUSG00000032855
Gene Namepolycystin 1, transient receptor poteintial channel interacting
SynonymsPC-1, polycystin-1, PC1
MMRRC Submission 039811-MU
Accession Numbers

Ncbi RefSeq: NM_013630.2; MGI:97603

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1780 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24549834-24596508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 24581569 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 3062 (S3062A)
Ref Sequence ENSEMBL: ENSMUSP00000049296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035565] [ENSMUST00000226883]
Predicted Effect probably benign
Transcript: ENSMUST00000035565
AA Change: S3062A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049296
Gene: ENSMUSG00000032855
AA Change: S3062A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 32 71 1.61e-8 SMART
LRR_TYP 90 113 2.47e-5 SMART
LRRCT 125 177 3.84e-12 SMART
WSC 177 271 6.93e-34 SMART
PKD 272 355 2.72e-15 SMART
CLECT 406 530 5.72e-20 SMART
low complexity region 545 558 N/A INTRINSIC
low complexity region 763 788 N/A INTRINSIC
PKD 930 1008 1.06e-8 SMART
PKD 1015 1119 2.26e-12 SMART
PKD 1122 1205 2.03e-14 SMART
PKD 1208 1288 1.14e-17 SMART
PKD 1290 1373 2.35e-10 SMART
PKD 1374 1459 7.63e-10 SMART
PKD 1464 1541 1.95e-16 SMART
PKD 1544 1625 1.05e-16 SMART
PKD 1631 1714 1.93e-1 SMART
PKD 1716 1798 2.21e-15 SMART
PKD 1799 1882 5.7e-9 SMART
PKD 1884 1964 1.56e-6 SMART
PKD 1968 2056 3.1e-10 SMART
PKD 2057 2140 1.74e-13 SMART
Pfam:REJ 2167 2610 1e-108 PFAM
low complexity region 2697 2706 N/A INTRINSIC
GPS 3003 3052 1.33e-12 SMART
transmembrane domain 3065 3087 N/A INTRINSIC
LH2 3110 3224 3.5e-18 SMART
transmembrane domain 3275 3294 N/A INTRINSIC
transmembrane domain 3314 3336 N/A INTRINSIC
low complexity region 3357 3378 N/A INTRINSIC
low complexity region 3479 3492 N/A INTRINSIC
transmembrane domain 3547 3569 N/A INTRINSIC
low complexity region 3573 3591 N/A INTRINSIC
low complexity region 3626 3639 N/A INTRINSIC
low complexity region 3661 3676 N/A INTRINSIC
Pfam:PKD_channel 3701 4103 7.1e-125 PFAM
low complexity region 4153 4172 N/A INTRINSIC
low complexity region 4238 4256 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226178
Predicted Effect probably benign
Transcript: ENSMUST00000226883
Predicted Effect unknown
Transcript: ENSMUST00000227107
AA Change: S725A
Predicted Effect probably benign
Transcript: ENSMUST00000227836
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency 98% (80/82)
MGI Phenotype Strain: Several; see below
Lethality: E13-E15
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutant embryos begin to die after embryonic day (E) 14.5. They develop edema by E13.5, pancreatic cysts by E15.5 and kidney cysts by E16.5. Heterozygous adults develop cysts of the kidneys (~20-30%) and the liver (~10%) late in life. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted(28) Gene trapped(3) Chemically induced(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,852,593 E493G probably damaging Het
Aff3 A T 1: 38,535,702 S66T probably damaging Het
Ankrd17 T A 5: 90,232,415 K2470N probably damaging Het
Ap3m1 T C 14: 21,041,070 T156A probably benign Het
Arhgef4 T A 1: 34,724,160 S832R possibly damaging Het
Asb10 T C 5: 24,533,676 D423G possibly damaging Het
Ash1l A G 3: 88,965,984 T25A probably benign Het
Atp13a2 T A 4: 141,002,460 L663I possibly damaging Het
Atp9b A T 18: 80,776,897 Y174* probably null Het
Bche A G 3: 73,700,620 I491T probably benign Het
Bckdhb T C 9: 83,953,783 probably null Het
Cadps2 C T 6: 23,320,932 probably null Het
Cdc42bpb A T 12: 111,322,907 V468E probably damaging Het
Chrnd T C 1: 87,192,548 V33A possibly damaging Het
Col6a5 A T 9: 105,936,878 V645D unknown Het
Cpa1 C T 6: 30,643,008 L312F probably damaging Het
Cyp2a5 A G 7: 26,841,876 probably benign Het
Cyp2c39 C A 19: 39,538,851 probably benign Het
Cyp2d26 T C 15: 82,794,007 N56S probably damaging Het
Ddx21 A G 10: 62,594,147 probably benign Het
Dnah11 A T 12: 118,027,558 C2358S probably damaging Het
Entpd8 T C 2: 25,084,306 S368P probably benign Het
Epg5 A T 18: 78,023,990 Q2222L probably damaging Het
Ercc5 T A 1: 44,167,796 V623E probably benign Het
Flg2 A G 3: 93,202,999 E778G unknown Het
Gbe1 C T 16: 70,495,324 R515* probably null Het
Hsd17b6 A G 10: 127,994,327 probably null Het
Hyal6 C T 6: 24,734,032 probably benign Het
Ifi27l2b A G 12: 103,451,319 I203T probably damaging Het
Kcnk9 A C 15: 72,512,401 D309E unknown Het
Lrp6 C T 6: 134,464,451 R1184Q probably damaging Het
Mdn1 T C 4: 32,700,103 F1399L probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mx1 T C 16: 97,451,512 *289W probably null Het
Myo7b T C 18: 31,961,185 E1970G probably damaging Het
Mypn T C 10: 63,121,964 Y24C probably damaging Het
Naxe G C 3: 88,057,133 P167A probably benign Het
Nmnat2 A T 1: 153,112,440 K272* probably null Het
Nmnat3 C T 9: 98,354,111 T19M probably damaging Het
Olfr1275 T C 2: 111,231,698 I32V probably benign Het
Olfr1412 G A 1: 92,588,389 V20M probably benign Het
Olfr1474 A G 19: 13,471,362 T131A probably benign Het
Olfr64 A T 7: 103,893,555 F60Y probably damaging Het
Olfr66 A G 7: 103,881,592 V217A probably benign Het
Pgm3 T G 9: 86,556,204 E509D probably damaging Het
Phf3 A T 1: 30,811,942 D1110E probably damaging Het
Pogz A T 3: 94,870,126 K372N possibly damaging Het
Pou1f1 A G 16: 65,523,470 Y15C probably benign Het
Ppfia2 A G 10: 106,896,507 T972A possibly damaging Het
Rasip1 A G 7: 45,635,318 Y703C possibly damaging Het
Recql T A 6: 142,364,598 Q502L probably benign Het
Rgs9 A T 11: 109,239,499 Y383* probably null Het
Rimbp3 T C 16: 17,212,632 S1307P probably benign Het
Rspo1 A G 4: 125,007,745 T200A probably damaging Het
Ryr3 C T 2: 112,867,292 M922I probably damaging Het
Samm50 C T 15: 84,211,127 A438V probably damaging Het
Sec1 A C 7: 45,678,832 S264A probably benign Het
Sec31a A T 5: 100,381,336 probably null Het
Slc13a3 T C 2: 165,406,699 N553S unknown Het
Smg6 T A 11: 74,946,116 L852Q probably damaging Het
Spata13 A G 14: 60,691,725 N244S probably damaging Het
Srbd1 T C 17: 86,057,685 R648G probably damaging Het
Sugct T G 13: 17,452,454 probably null Het
Tmed10 A G 12: 85,354,879 Y85H probably damaging Het
Trim68 A G 7: 102,684,073 I134T possibly damaging Het
Trio A G 15: 27,744,038 C2603R possibly damaging Het
Tspyl3 G A 2: 153,225,256 R21W probably damaging Het
Ttn T C 2: 76,810,699 I11863V probably null Het
Ubp1 G A 9: 113,964,579 A283T possibly damaging Het
Ubtf A T 11: 102,314,918 F60L probably damaging Het
Vmn1r235 T C 17: 21,261,737 I108T probably benign Het
Vmn2r125 T C 4: 156,351,373 S349P probably damaging Het
Vmn2r25 A G 6: 123,828,465 S478P probably damaging Het
Vmn2r88 T A 14: 51,418,572 V746D probably damaging Het
Zcwpw1 A G 5: 137,796,652 K37E probably damaging Het
Zdhhc24 T C 19: 4,883,766 S284P probably damaging Het
Zswim8 C A 14: 20,716,327 H841N probably damaging Het
Other mutations in Pkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pkd1 APN 17 24580095 missense probably damaging 1.00
IGL00503:Pkd1 APN 17 24565427 missense probably benign
IGL00549:Pkd1 APN 17 24572761 missense probably benign
IGL00573:Pkd1 APN 17 24594530 nonsense probably null
IGL00924:Pkd1 APN 17 24571627 nonsense probably null
IGL01319:Pkd1 APN 17 24587919 unclassified probably benign
IGL01326:Pkd1 APN 17 24576174 nonsense probably null
IGL01457:Pkd1 APN 17 24594821 unclassified probably null
IGL01541:Pkd1 APN 17 24586298 missense probably damaging 1.00
IGL01575:Pkd1 APN 17 24573128 missense probably damaging 1.00
IGL01606:Pkd1 APN 17 24576523 missense probably damaging 0.97
IGL01642:Pkd1 APN 17 24581292 missense probably damaging 1.00
IGL01888:Pkd1 APN 17 24585815 missense possibly damaging 0.91
IGL01940:Pkd1 APN 17 24579746 missense possibly damaging 0.63
IGL01958:Pkd1 APN 17 24580324 missense probably damaging 1.00
IGL02005:Pkd1 APN 17 24586004 missense possibly damaging 0.67
IGL02121:Pkd1 APN 17 24575927 missense probably benign 0.03
IGL02148:Pkd1 APN 17 24579836 missense probably damaging 1.00
IGL02409:Pkd1 APN 17 24573623 missense probably benign 0.01
IGL02442:Pkd1 APN 17 24565226 missense probably benign 0.41
IGL02498:Pkd1 APN 17 24585779 missense possibly damaging 0.91
IGL02501:Pkd1 APN 17 24569699 missense probably benign 0.01
IGL02551:Pkd1 APN 17 24573815 missense probably damaging 1.00
IGL02635:Pkd1 APN 17 24572811 missense probably damaging 1.00
IGL02673:Pkd1 APN 17 24571283 missense probably benign 0.40
IGL02808:Pkd1 APN 17 24593504 missense probably damaging 1.00
IGL02816:Pkd1 APN 17 24594515 missense probably benign 0.00
IGL02863:Pkd1 APN 17 24569752 missense possibly damaging 0.56
IGL02927:Pkd1 APN 17 24575189 missense probably damaging 1.00
IGL02961:Pkd1 APN 17 24578115 missense possibly damaging 0.81
IGL03003:Pkd1 APN 17 24593603 critical splice donor site probably null
IGL03066:Pkd1 APN 17 24586234 missense probably damaging 1.00
IGL03182:Pkd1 APN 17 24573818 missense probably damaging 0.98
IGL03384:Pkd1 APN 17 24565897 missense probably benign 0.00
IGL03404:Pkd1 APN 17 24564406 missense probably damaging 0.97
PIT1430001:Pkd1 UTSW 17 24569511 missense probably damaging 0.99
R0017:Pkd1 UTSW 17 24578539 critical splice donor site probably null
R0017:Pkd1 UTSW 17 24578539 critical splice donor site probably null
R0022:Pkd1 UTSW 17 24594819 missense probably damaging 0.98
R0022:Pkd1 UTSW 17 24594819 missense probably damaging 0.98
R0058:Pkd1 UTSW 17 24564703 missense probably benign 0.06
R0058:Pkd1 UTSW 17 24564703 missense probably benign 0.06
R0085:Pkd1 UTSW 17 24586223 missense probably damaging 0.98
R0094:Pkd1 UTSW 17 24581276 missense possibly damaging 0.80
R0094:Pkd1 UTSW 17 24581276 missense possibly damaging 0.80
R0135:Pkd1 UTSW 17 24565071 missense possibly damaging 0.85
R0304:Pkd1 UTSW 17 24585946 missense probably damaging 1.00
R0427:Pkd1 UTSW 17 24593502 missense probably damaging 0.98
R0502:Pkd1 UTSW 17 24574792 missense probably damaging 0.99
R0518:Pkd1 UTSW 17 24595219 missense probably benign 0.01
R0521:Pkd1 UTSW 17 24595219 missense probably benign 0.01
R0544:Pkd1 UTSW 17 24585683 missense probably damaging 1.00
R0546:Pkd1 UTSW 17 24580138 missense probably benign 0.44
R0626:Pkd1 UTSW 17 24575575 missense probably damaging 0.96
R0648:Pkd1 UTSW 17 24594937 missense probably damaging 1.00
R1138:Pkd1 UTSW 17 24586032 missense probably damaging 1.00
R1302:Pkd1 UTSW 17 24568236 missense probably benign 0.00
R1306:Pkd1 UTSW 17 24573172 missense probably damaging 0.97
R1349:Pkd1 UTSW 17 24575266 missense probably damaging 1.00
R1372:Pkd1 UTSW 17 24575266 missense probably damaging 1.00
R1437:Pkd1 UTSW 17 24595132 missense probably damaging 1.00
R1515:Pkd1 UTSW 17 24594853 missense probably benign 0.01
R1605:Pkd1 UTSW 17 24577526 missense possibly damaging 0.95
R1622:Pkd1 UTSW 17 24581640 missense probably benign
R1623:Pkd1 UTSW 17 24578269 missense probably damaging 0.99
R1726:Pkd1 UTSW 17 24564176 missense probably damaging 0.96
R1756:Pkd1 UTSW 17 24594485 missense probably damaging 1.00
R1785:Pkd1 UTSW 17 24591099 missense probably benign 0.00
R1829:Pkd1 UTSW 17 24565584 missense probably benign
R1869:Pkd1 UTSW 17 24594931 missense probably damaging 1.00
R1920:Pkd1 UTSW 17 24595157 missense probably damaging 0.99
R1922:Pkd1 UTSW 17 24595157 missense probably damaging 0.99
R1987:Pkd1 UTSW 17 24576592 splice site probably null
R1988:Pkd1 UTSW 17 24576592 splice site probably null
R1998:Pkd1 UTSW 17 24573014 missense probably damaging 1.00
R2007:Pkd1 UTSW 17 24579785 missense probably damaging 1.00
R2019:Pkd1 UTSW 17 24568684 nonsense probably null
R2054:Pkd1 UTSW 17 24574796 missense probably benign 0.00
R2061:Pkd1 UTSW 17 24569914 missense possibly damaging 0.89
R2196:Pkd1 UTSW 17 24580072 missense possibly damaging 0.60
R2203:Pkd1 UTSW 17 24580889 missense probably benign 0.01
R2301:Pkd1 UTSW 17 24574612 missense probably benign
R2655:Pkd1 UTSW 17 24576490 missense probably damaging 0.99
R2860:Pkd1 UTSW 17 24565446 missense probably benign 0.43
R2861:Pkd1 UTSW 17 24565446 missense probably benign 0.43
R3000:Pkd1 UTSW 17 24594486 missense probably damaging 1.00
R3150:Pkd1 UTSW 17 24579791 missense probably benign 0.00
R3747:Pkd1 UTSW 17 24591461 missense possibly damaging 0.67
R3812:Pkd1 UTSW 17 24565641 missense probably benign 0.00
R3859:Pkd1 UTSW 17 24578092 splice site probably benign
R3893:Pkd1 UTSW 17 24572110 critical splice donor site probably null
R3947:Pkd1 UTSW 17 24578037 splice site probably benign
R3949:Pkd1 UTSW 17 24578037 splice site probably benign
R4176:Pkd1 UTSW 17 24587997 missense probably benign 0.17
R4199:Pkd1 UTSW 17 24570030 missense probably benign 0.41
R4225:Pkd1 UTSW 17 24593523 missense possibly damaging 0.50
R4439:Pkd1 UTSW 17 24585692 missense probably damaging 1.00
R4476:Pkd1 UTSW 17 24576526 missense probably damaging 1.00
R4716:Pkd1 UTSW 17 24576133 missense probably damaging 1.00
R4801:Pkd1 UTSW 17 24578096 missense probably damaging 1.00
R4802:Pkd1 UTSW 17 24578096 missense probably damaging 1.00
R4817:Pkd1 UTSW 17 24565374 unclassified probably null
R4903:Pkd1 UTSW 17 24572002 missense probably benign 0.30
R4910:Pkd1 UTSW 17 24572687 missense probably damaging 1.00
R4964:Pkd1 UTSW 17 24586068 critical splice donor site probably null
R4966:Pkd1 UTSW 17 24586068 critical splice donor site probably null
R5040:Pkd1 UTSW 17 24571260 missense probably benign 0.02
R5042:Pkd1 UTSW 17 24569887 missense probably benign 0.00
R5088:Pkd1 UTSW 17 24590838 missense possibly damaging 0.94
R5121:Pkd1 UTSW 17 24573463 missense probably benign
R5296:Pkd1 UTSW 17 24576074 missense probably damaging 1.00
R5338:Pkd1 UTSW 17 24594536 missense probably benign
R5356:Pkd1 UTSW 17 24593577 missense probably damaging 0.97
R5357:Pkd1 UTSW 17 24565790 missense probably damaging 1.00
R5363:Pkd1 UTSW 17 24565073 missense probably benign
R5383:Pkd1 UTSW 17 24574375 missense probably benign
R5622:Pkd1 UTSW 17 24574040 missense possibly damaging 0.67
R5651:Pkd1 UTSW 17 24591387 missense possibly damaging 0.88
R5664:Pkd1 UTSW 17 24569371 missense probably damaging 0.99
R5723:Pkd1 UTSW 17 24565523 missense probably benign 0.01
R5797:Pkd1 UTSW 17 24592641 missense possibly damaging 0.55
R5838:Pkd1 UTSW 17 24580212 missense possibly damaging 0.75
R5866:Pkd1 UTSW 17 24580961 missense probably damaging 0.99
R5873:Pkd1 UTSW 17 24569830 missense probably benign
R5906:Pkd1 UTSW 17 24572920 missense probably benign 0.16
R6047:Pkd1 UTSW 17 24595085 missense probably damaging 1.00
R6076:Pkd1 UTSW 17 24581030 missense probably benign 0.14
R6151:Pkd1 UTSW 17 24575606 missense probably benign 0.00
R6252:Pkd1 UTSW 17 24581226 missense probably damaging 0.98
R6341:Pkd1 UTSW 17 24580227 missense probably damaging 1.00
R6540:Pkd1 UTSW 17 24575977 missense probably damaging 1.00
R6732:Pkd1 UTSW 17 24569413 missense probably damaging 1.00
R6836:Pkd1 UTSW 17 24581259 missense probably damaging 1.00
R6856:Pkd1 UTSW 17 24573493 missense probably benign 0.05
R6865:Pkd1 UTSW 17 24576487 missense probably benign 0.43
R6999:Pkd1 UTSW 17 24578501 missense possibly damaging 0.62
R7077:Pkd1 UTSW 17 24591119 missense not run
R7123:Pkd1 UTSW 17 24594768 missense not run
R7134:Pkd1 UTSW 17 24594112 missense not run
X0024:Pkd1 UTSW 17 24591392 missense possibly damaging 0.68
X0061:Pkd1 UTSW 17 24594931 missense probably damaging 1.00
X0065:Pkd1 UTSW 17 24586164 missense probably benign 0.19
Z1088:Pkd1 UTSW 17 24565605 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGAACCTGACGAGCCATTTCCAC -3'
(R):5'- TCCATAATCACCAGACAGGGTCCAG -3'

Sequencing Primer
(F):5'- CCTGTGCCAGTACTTCAGTGAG -3'
(R):5'- TAGACCAGGGTAGACGCCATATC -3'
Posted On2014-05-23