Incidental Mutation 'R1195:Cntnap2'
ID197530
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Namecontactin associated protein-like 2
Synonyms5430425M22Rik, Caspr2
MMRRC Submission 039267-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R1195 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location45059357-47304213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46483968 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 646 (M646K)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641]
Predicted Effect probably benign
Transcript: ENSMUST00000114641
AA Change: M646K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: M646K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203319
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AC073561.5 A T 12: 114,479,395 probably benign Het
Agtr1a C A 13: 30,381,918 P322Q probably damaging Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Brd1 T C 15: 88,700,811 E940G probably benign Het
Cd163 T A 6: 124,325,250 probably benign Het
Cd28 C T 1: 60,763,144 T74I possibly damaging Het
Cyb5d1 C T 11: 69,394,971 probably null Het
D430042O09Rik A G 7: 125,866,482 R1343G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dab2ip T C 2: 35,718,745 probably benign Het
Dnajc25 C T 4: 59,003,415 A62V probably damaging Het
Dst A G 1: 34,211,154 D4063G probably damaging Het
Elmod1 T C 9: 53,935,768 Y42C probably damaging Het
Fam129b T C 2: 32,919,803 V304A probably benign Het
Hdac5 T C 11: 102,205,506 I310V probably damaging Het
Hpx A G 7: 105,599,649 probably benign Het
Igsf3 A G 3: 101,458,103 D1130G probably benign Het
Kdm4d A G 9: 14,463,099 S488P probably benign Het
Lingo2 A G 4: 35,708,538 Y481H probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k20 C T 2: 72,438,218 P523L probably damaging Het
Msx1 A G 5: 37,821,281 Y297H probably damaging Het
Myo9a A G 9: 59,895,200 D1990G probably damaging Het
Perp C A 10: 18,855,735 Y147* probably null Het
Prr16 A T 18: 51,302,683 D78V probably damaging Het
Rfx7 C T 9: 72,617,946 T806M probably damaging Het
Robo2 T C 16: 73,916,128 probably null Het
Sema5b A T 16: 35,651,660 E496V probably null Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spdl1 T C 11: 34,819,817 Y368C probably damaging Het
Sptbn2 G C 19: 4,745,893 R1700P possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tln2 T G 9: 67,258,566 K1000Q probably damaging Het
Tmbim7 A G 5: 3,661,943 T63A probably benign Het
Tmed11 T C 5: 108,779,019 D129G possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttll6 T C 11: 96,135,729 I113T probably damaging Het
Uso1 T A 5: 92,170,747 F210L probably damaging Het
Uspl1 T A 5: 149,194,321 V224E probably benign Het
Zfp639 G A 3: 32,519,196 V86I possibly damaging Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 46015263 missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46988787 missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47193038 missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46484072 missense probably benign
IGL00857:Cntnap2 APN 6 47049424 missense probably benign 0.00
IGL01290:Cntnap2 APN 6 46015465 missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47193013 missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47271371 nonsense probably null
IGL01859:Cntnap2 APN 6 46988721 missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46234203 missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 47021654 missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46234320 missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 47021736 missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47095549 missense possibly damaging 0.66
IGL02802:Cntnap2 UTSW 6 46170245 missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46530171 missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46483983 missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45060392 splice site probably null
R0352:Cntnap2 UTSW 6 45992084 splice site probably null
R0389:Cntnap2 UTSW 6 46009637 missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45715816 missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46529905 nonsense probably null
R0611:Cntnap2 UTSW 6 47095549 missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46988760 missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47296708 splice site probably benign
R0976:Cntnap2 UTSW 6 47271230 missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1387:Cntnap2 UTSW 6 47107914 missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46530679 missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 46015330 missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47107892 nonsense probably null
R1757:Cntnap2 UTSW 6 46759829 missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46988675 missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46530633 missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47298588 missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47298445 missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 46015266 missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45991903 missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46856128 missense probably benign
R4030:Cntnap2 UTSW 6 46856128 missense probably benign
R4237:Cntnap2 UTSW 6 46530390 intron probably benign
R4445:Cntnap2 UTSW 6 46759851 missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46530035 intron probably benign
R4918:Cntnap2 UTSW 6 46530035 intron probably benign
R4999:Cntnap2 UTSW 6 45920834 missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45920926 nonsense probably null
R5748:Cntnap2 UTSW 6 45715884 missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46529815 intron probably benign
R6118:Cntnap2 UTSW 6 47193077 missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46759808 missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47271298 missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45060112 utr 5 prime probably null
R6385:Cntnap2 UTSW 6 46856180 missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46759760 missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46170272 missense probably benign 0.25
R6610:Cntnap2 UTSW 6 46015257 missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47049373 missense probably benign 0.27
X0018:Cntnap2 UTSW 6 46009518 missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 47021754 missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46234245 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTGTCGGGATTGCTCCCTCTAAC -3'
(R):5'- GCACATTGAGGACTGAAGACTGGAC -3'

Sequencing Primer
(F):5'- AACTCGGTTTTATTCCAGTCTAATG -3'
(R):5'- TAATAAGCCACACCTGTTGGG -3'
Posted On2014-05-23