Incidental Mutation 'R1195:Sptbn2'
ID 197554
Institutional Source Beutler Lab
Gene Symbol Sptbn2
Ensembl Gene ENSMUSG00000067889
Gene Name spectrin beta, non-erythrocytic 2
Synonyms Spnb3
MMRRC Submission 039267-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1195 (G1)
Quality Score 85
Status Validated
Chromosome 19
Chromosomal Location 4761195-4802388 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 4795921 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Proline at position 1700 (R1700P)
Ref Sequence ENSEMBL: ENSMUSP00000008991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008991] [ENSMUST00000178353]
AlphaFold Q68FG2
Predicted Effect possibly damaging
Transcript: ENSMUST00000008991
AA Change: R1700P

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: R1700P

DomainStartEndE-ValueType
CH 59 159 1.86e-28 SMART
CH 178 276 2.86e-20 SMART
SPEC 308 414 4.63e-1 SMART
SPEC 428 528 3.07e-23 SMART
SPEC 534 638 4.47e-25 SMART
SPEC 644 744 1.28e-25 SMART
SPEC 750 849 4.98e-23 SMART
SPEC 855 955 1.63e-18 SMART
SPEC 961 1062 1.45e-24 SMART
SPEC 1068 1169 4.15e-20 SMART
SPEC 1175 1275 5.26e-22 SMART
SPEC 1281 1380 1.17e-19 SMART
SPEC 1386 1485 2.06e-24 SMART
SPEC 1491 1585 1.74e-22 SMART
SPEC 1591 1691 5.42e-24 SMART
SPEC 1697 1798 2.1e-21 SMART
SPEC 1804 1904 5.47e-20 SMART
SPEC 1910 2010 1.99e-22 SMART
SPEC 2016 2256 2.92e-6 SMART
PH 2219 2330 1.65e-14 SMART
low complexity region 2373 2386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178353
SMART Domains Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 118 5.6e-7 PFAM
Meta Mutation Damage Score 0.1414 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a C A 13: 30,565,901 (GRCm39) P322Q probably damaging Het
Amh AGCGCCTTGG AG 10: 80,641,419 (GRCm39) probably null Het
Brd1 T C 15: 88,585,014 (GRCm39) E940G probably benign Het
Cd163 T A 6: 124,302,209 (GRCm39) probably benign Het
Cd28 C T 1: 60,802,303 (GRCm39) T74I possibly damaging Het
Cntnap2 T A 6: 46,460,902 (GRCm39) M646K probably benign Het
Cyb5d1 C T 11: 69,285,797 (GRCm39) probably null Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Dab2ip T C 2: 35,608,757 (GRCm39) probably benign Het
Dnajc25 C T 4: 59,003,415 (GRCm39) A62V probably damaging Het
Dst A G 1: 34,250,235 (GRCm39) D4063G probably damaging Het
Elmod1 T C 9: 53,843,052 (GRCm39) Y42C probably damaging Het
Hdac5 T C 11: 102,096,332 (GRCm39) I310V probably damaging Het
Hpx A G 7: 105,248,856 (GRCm39) probably benign Het
Ighv10-1 A T 12: 114,443,015 (GRCm39) probably benign Het
Igsf3 A G 3: 101,365,419 (GRCm39) D1130G probably benign Het
Katnip A G 7: 125,465,654 (GRCm39) R1343G probably damaging Het
Kdm4d A G 9: 14,374,395 (GRCm39) S488P probably benign Het
Lingo2 A G 4: 35,708,538 (GRCm39) Y481H probably damaging Het
Ltbp1 A G 17: 75,532,280 (GRCm39) Q118R possibly damaging Het
Map3k20 C T 2: 72,268,562 (GRCm39) P523L probably damaging Het
Msx1 A G 5: 37,978,625 (GRCm39) Y297H probably damaging Het
Myo9a A G 9: 59,802,483 (GRCm39) D1990G probably damaging Het
Niban2 T C 2: 32,809,815 (GRCm39) V304A probably benign Het
Perp C A 10: 18,731,483 (GRCm39) Y147* probably null Het
Prr16 A T 18: 51,435,755 (GRCm39) D78V probably damaging Het
Rfx7 C T 9: 72,525,228 (GRCm39) T806M probably damaging Het
Robo2 T C 16: 73,713,016 (GRCm39) probably null Het
Sema5b A T 16: 35,472,030 (GRCm39) E496V probably null Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Spdl1 T C 11: 34,710,644 (GRCm39) Y368C probably damaging Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Tln2 T G 9: 67,165,848 (GRCm39) K1000Q probably damaging Het
Tmbim7 A G 5: 3,711,943 (GRCm39) T63A probably benign Het
Tmed11 T C 5: 108,926,885 (GRCm39) D129G possibly damaging Het
Ttc28 G A 5: 111,373,543 (GRCm39) S962N probably damaging Het
Ttll6 T C 11: 96,026,555 (GRCm39) I113T probably damaging Het
Uso1 T A 5: 92,318,606 (GRCm39) F210L probably damaging Het
Uspl1 T A 5: 149,131,131 (GRCm39) V224E probably benign Het
Zfp639 G A 3: 32,573,345 (GRCm39) V86I possibly damaging Het
Other mutations in Sptbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sptbn2 APN 19 4,774,733 (GRCm39) missense possibly damaging 0.94
IGL00688:Sptbn2 APN 19 4,775,966 (GRCm39) missense probably damaging 1.00
IGL01339:Sptbn2 APN 19 4,796,000 (GRCm39) nonsense probably null
IGL01373:Sptbn2 APN 19 4,796,000 (GRCm39) nonsense probably null
IGL01420:Sptbn2 APN 19 4,784,153 (GRCm39) missense probably benign
IGL01456:Sptbn2 APN 19 4,796,777 (GRCm39) missense probably damaging 1.00
IGL01953:Sptbn2 APN 19 4,799,721 (GRCm39) missense probably benign
IGL03026:Sptbn2 APN 19 4,774,261 (GRCm39) critical splice donor site probably null
IGL03275:Sptbn2 APN 19 4,782,689 (GRCm39) missense possibly damaging 0.65
IGL03286:Sptbn2 APN 19 4,797,860 (GRCm39) missense probably damaging 0.97
F5770:Sptbn2 UTSW 19 4,800,660 (GRCm39) missense probably damaging 1.00
PIT4696001:Sptbn2 UTSW 19 4,795,605 (GRCm39) missense probably benign 0.00
R0046:Sptbn2 UTSW 19 4,795,405 (GRCm39) intron probably benign
R0046:Sptbn2 UTSW 19 4,795,405 (GRCm39) intron probably benign
R0121:Sptbn2 UTSW 19 4,795,321 (GRCm39) missense probably damaging 1.00
R0127:Sptbn2 UTSW 19 4,774,772 (GRCm39) missense probably damaging 1.00
R0212:Sptbn2 UTSW 19 4,796,970 (GRCm39) critical splice donor site probably null
R0277:Sptbn2 UTSW 19 4,795,173 (GRCm39) missense probably benign 0.28
R0417:Sptbn2 UTSW 19 4,787,954 (GRCm39) missense probably benign 0.01
R0457:Sptbn2 UTSW 19 4,795,966 (GRCm39) missense possibly damaging 0.89
R0536:Sptbn2 UTSW 19 4,776,718 (GRCm39) missense probably damaging 0.99
R0631:Sptbn2 UTSW 19 4,790,014 (GRCm39) missense probably benign 0.01
R0734:Sptbn2 UTSW 19 4,798,151 (GRCm39) nonsense probably null
R0742:Sptbn2 UTSW 19 4,769,011 (GRCm39) missense possibly damaging 0.46
R1195:Sptbn2 UTSW 19 4,795,921 (GRCm39) missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4,795,921 (GRCm39) missense possibly damaging 0.85
R1364:Sptbn2 UTSW 19 4,782,693 (GRCm39) missense probably damaging 1.00
R1495:Sptbn2 UTSW 19 4,769,004 (GRCm39) missense possibly damaging 0.92
R1498:Sptbn2 UTSW 19 4,794,274 (GRCm39) missense possibly damaging 0.94
R1606:Sptbn2 UTSW 19 4,800,270 (GRCm39) critical splice donor site probably null
R1678:Sptbn2 UTSW 19 4,800,525 (GRCm39) missense probably damaging 1.00
R1746:Sptbn2 UTSW 19 4,795,992 (GRCm39) nonsense probably null
R1820:Sptbn2 UTSW 19 4,776,624 (GRCm39) missense probably damaging 0.98
R1830:Sptbn2 UTSW 19 4,782,569 (GRCm39) missense probably benign 0.09
R1863:Sptbn2 UTSW 19 4,782,713 (GRCm39) missense possibly damaging 0.54
R1967:Sptbn2 UTSW 19 4,795,327 (GRCm39) missense probably benign 0.00
R2085:Sptbn2 UTSW 19 4,788,587 (GRCm39) missense probably benign 0.09
R2301:Sptbn2 UTSW 19 4,784,166 (GRCm39) missense probably benign 0.00
R2310:Sptbn2 UTSW 19 4,768,963 (GRCm39) missense probably benign 0.19
R2888:Sptbn2 UTSW 19 4,798,664 (GRCm39) missense possibly damaging 0.52
R3788:Sptbn2 UTSW 19 4,795,950 (GRCm39) missense probably damaging 1.00
R4429:Sptbn2 UTSW 19 4,788,383 (GRCm39) missense probably damaging 1.00
R4536:Sptbn2 UTSW 19 4,782,630 (GRCm39) missense probably damaging 1.00
R4662:Sptbn2 UTSW 19 4,789,267 (GRCm39) missense probably damaging 1.00
R4672:Sptbn2 UTSW 19 4,782,524 (GRCm39) missense probably benign 0.25
R4731:Sptbn2 UTSW 19 4,792,508 (GRCm39) missense probably damaging 0.96
R4747:Sptbn2 UTSW 19 4,798,182 (GRCm39) missense probably benign 0.27
R4889:Sptbn2 UTSW 19 4,779,458 (GRCm39) missense possibly damaging 0.69
R4891:Sptbn2 UTSW 19 4,788,497 (GRCm39) missense probably damaging 1.00
R4965:Sptbn2 UTSW 19 4,779,337 (GRCm39) missense probably benign 0.13
R4968:Sptbn2 UTSW 19 4,779,230 (GRCm39) splice site probably null
R4981:Sptbn2 UTSW 19 4,801,686 (GRCm39) missense probably benign 0.22
R5159:Sptbn2 UTSW 19 4,787,885 (GRCm39) missense probably benign 0.12
R5202:Sptbn2 UTSW 19 4,774,212 (GRCm39) missense probably damaging 1.00
R5253:Sptbn2 UTSW 19 4,800,110 (GRCm39) missense probably benign 0.01
R5294:Sptbn2 UTSW 19 4,768,936 (GRCm39) missense possibly damaging 0.67
R5465:Sptbn2 UTSW 19 4,800,133 (GRCm39) missense probably benign 0.00
R5546:Sptbn2 UTSW 19 4,775,978 (GRCm39) missense probably damaging 1.00
R5593:Sptbn2 UTSW 19 4,798,975 (GRCm39) missense probably damaging 1.00
R5780:Sptbn2 UTSW 19 4,774,695 (GRCm39) missense probably damaging 1.00
R5835:Sptbn2 UTSW 19 4,788,247 (GRCm39) missense probably damaging 1.00
R6008:Sptbn2 UTSW 19 4,789,306 (GRCm39) missense possibly damaging 0.89
R6108:Sptbn2 UTSW 19 4,781,420 (GRCm39) critical splice donor site probably null
R6236:Sptbn2 UTSW 19 4,798,166 (GRCm39) missense probably benign 0.01
R6307:Sptbn2 UTSW 19 4,774,674 (GRCm39) missense probably damaging 1.00
R6383:Sptbn2 UTSW 19 4,782,524 (GRCm39) missense possibly damaging 0.89
R6397:Sptbn2 UTSW 19 4,792,446 (GRCm39) missense possibly damaging 0.91
R6453:Sptbn2 UTSW 19 4,794,208 (GRCm39) missense possibly damaging 0.67
R6561:Sptbn2 UTSW 19 4,797,954 (GRCm39) missense probably benign 0.39
R6564:Sptbn2 UTSW 19 4,782,052 (GRCm39) missense probably damaging 1.00
R6644:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R6703:Sptbn2 UTSW 19 4,799,843 (GRCm39) missense probably benign
R6703:Sptbn2 UTSW 19 4,799,842 (GRCm39) missense probably benign
R6753:Sptbn2 UTSW 19 4,797,813 (GRCm39) missense probably benign 0.01
R7007:Sptbn2 UTSW 19 4,794,173 (GRCm39) missense possibly damaging 0.82
R7131:Sptbn2 UTSW 19 4,799,488 (GRCm39) missense probably null
R7219:Sptbn2 UTSW 19 4,774,201 (GRCm39) missense probably damaging 1.00
R7285:Sptbn2 UTSW 19 4,787,471 (GRCm39) missense probably benign 0.00
R7308:Sptbn2 UTSW 19 4,801,602 (GRCm39) missense probably benign
R7469:Sptbn2 UTSW 19 4,795,146 (GRCm39) missense probably benign 0.00
R7502:Sptbn2 UTSW 19 4,798,110 (GRCm39) missense probably benign 0.02
R7623:Sptbn2 UTSW 19 4,776,196 (GRCm39) missense probably damaging 1.00
R7635:Sptbn2 UTSW 19 4,794,235 (GRCm39) missense probably damaging 1.00
R7733:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7738:Sptbn2 UTSW 19 4,774,153 (GRCm39) missense probably damaging 1.00
R7742:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7767:Sptbn2 UTSW 19 4,784,171 (GRCm39) missense possibly damaging 0.62
R7795:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7796:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7871:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7877:Sptbn2 UTSW 19 4,794,290 (GRCm39) missense possibly damaging 0.93
R7920:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7921:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7923:Sptbn2 UTSW 19 4,796,827 (GRCm39) missense probably benign 0.01
R8137:Sptbn2 UTSW 19 4,787,431 (GRCm39) missense possibly damaging 0.81
R8305:Sptbn2 UTSW 19 4,779,158 (GRCm39) missense possibly damaging 0.81
R8695:Sptbn2 UTSW 19 4,796,724 (GRCm39) missense possibly damaging 0.86
R8790:Sptbn2 UTSW 19 4,782,052 (GRCm39) missense probably damaging 1.00
R9125:Sptbn2 UTSW 19 4,784,241 (GRCm39) missense probably benign 0.04
R9483:Sptbn2 UTSW 19 4,789,974 (GRCm39) missense probably damaging 1.00
R9620:Sptbn2 UTSW 19 4,800,535 (GRCm39) missense probably damaging 0.99
R9631:Sptbn2 UTSW 19 4,788,218 (GRCm39) missense probably damaging 1.00
R9646:Sptbn2 UTSW 19 4,795,341 (GRCm39) missense probably damaging 1.00
R9694:Sptbn2 UTSW 19 4,800,535 (GRCm39) missense probably damaging 0.99
V7580:Sptbn2 UTSW 19 4,800,660 (GRCm39) missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4,795,219 (GRCm39) missense probably benign 0.01
Z1176:Sptbn2 UTSW 19 4,788,233 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGACACAGAGCAAGCCATTC -3'
(R):5'- GGCTAGATTTCTGCACCAGAGGAC -3'

Sequencing Primer
(F):5'- GAGCAAGCCATTCTCTCTACC -3'
(R):5'- GCTCAAAAGTTGTGCAGAACTC -3'
Posted On 2014-05-23