Incidental Mutation 'R1467:Lrp1b'
ID197569
Institutional Source Beutler Lab
Gene Symbol Lrp1b
Ensembl Gene ENSMUSG00000049252
Gene Namelow density lipoprotein-related protein 1B (deleted in tumors)
Synonyms9630004P12Rik
MMRRC Submission 039520-MU
Accession Numbers

Genbank: NM_053011.2

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1467 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location40595246-42653624 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 40657356 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052550] [ENSMUST00000203015]
Predicted Effect probably benign
Transcript: ENSMUST00000052550
SMART Domains Protein: ENSMUSP00000054275
Gene: ENSMUSG00000049252

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 35 46 N/A INTRINSIC
LDLa 62 102 2.97e-12 SMART
LDLa 107 146 1.31e-8 SMART
EGF 150 185 1.95e1 SMART
EGF_CA 186 225 8.37e-8 SMART
LY 256 300 4.06e1 SMART
LY 304 348 1.15e-5 SMART
LY 349 392 1.17e-11 SMART
LY 393 435 1.12e-8 SMART
LY 436 478 2.21e1 SMART
EGF 505 548 2.45e0 SMART
LY 579 621 1.32e-5 SMART
LY 622 665 1.88e-10 SMART
LY 668 717 1.47e-12 SMART
LY 718 760 5.78e-11 SMART
LY 761 802 1.45e0 SMART
EGF_like 828 865 4.55e1 SMART
LDLa 875 914 7.15e-15 SMART
LDLa 916 955 5.26e-13 SMART
LDLa 957 995 6.13e-14 SMART
LDLa 997 1035 6.47e-13 SMART
LDLa 1036 1075 1.76e-14 SMART
LDLa 1083 1121 2.29e-13 SMART
LDLa 1125 1164 3.36e-11 SMART
LDLa 1166 1206 2.57e-7 SMART
EGF 1206 1244 1.58e-3 SMART
EGF 1248 1284 4.56e0 SMART
LY 1311 1353 4.85e-4 SMART
LY 1358 1400 6.49e-14 SMART
LY 1401 1445 8.18e-11 SMART
LY 1446 1490 4.25e-9 SMART
LY 1492 1534 5.4e-2 SMART
EGF 1561 1601 9.41e-2 SMART
LY 1629 1671 3.03e-5 SMART
LY 1672 1716 1.22e-9 SMART
LY 1718 1756 1.02e-2 SMART
LY 1757 1798 8.25e-7 SMART
EGF 1868 1906 4.03e-1 SMART
LY 1933 1975 1.01e-1 SMART
LY 1976 2018 3.03e-14 SMART
LY 2019 2062 2.16e-10 SMART
LY 2063 2105 4.09e-11 SMART
LY 2107 2149 9.96e0 SMART
EGF 2177 2214 2.13e0 SMART
LY 2292 2334 6.96e-5 SMART
LY 2340 2385 1.07e-5 SMART
LY 2386 2428 1.1e-11 SMART
LY 2429 2470 4.78e-3 SMART
EGF 2498 2535 2.03e1 SMART
LDLa 2540 2580 1.1e-6 SMART
LDLa 2582 2619 1.72e-8 SMART
LDLa 2621 2658 2.45e-13 SMART
LDLa 2669 2707 6.53e-9 SMART
LDLa 2712 2749 7.97e-13 SMART
LDLa 2750 2789 1.22e-8 SMART
LDLa 2791 2832 3.07e-14 SMART
LDLa 2835 2873 7.32e-12 SMART
LDLa 2875 2917 1.85e-8 SMART
LDLa 2921 2958 4.76e-11 SMART
EGF_CA 2957 2998 1.79e-7 SMART
EGF_CA 2999 3039 1.85e-9 SMART
LY 3066 3111 2.58e-8 SMART
LY 3112 3152 1.22e-9 SMART
LY 3153 3196 8.84e-7 SMART
LY 3197 3237 3.22e-9 SMART
LY 3238 3279 1.04e-3 SMART
EGF 3307 3345 7.13e-2 SMART
LDLa 3347 3385 9.29e-14 SMART
LDLa 3387 3424 2.25e-12 SMART
LDLa 3426 3464 5.63e-13 SMART
LDLa 3466 3504 1.07e-13 SMART
LDLa 3506 3543 1.35e-15 SMART
EGF_like 3545 3581 2.8e1 SMART
LDLa 3545 3582 1.49e-12 SMART
LDLa 3583 3620 4.21e-12 SMART
LDLa 3624 3661 4.9e-13 SMART
LDLa 3662 3700 9.58e-16 SMART
LDLa 3704 3743 5.38e-10 SMART
LDLa 3745 3784 1.42e-9 SMART
LDLa 3792 3829 3.66e-12 SMART
EGF 3835 3874 3.71e0 SMART
EGF_CA 3875 3912 6.8e-8 SMART
LY 3987 4033 4.24e0 SMART
LY 4050 4093 4.46e-3 SMART
LY 4094 4136 1.73e-9 SMART
EGF 4206 4239 2.45e0 SMART
EGF 4247 4280 2.48e-1 SMART
EGF 4283 4316 1.49e-4 SMART
EGF 4319 4352 1.69e-3 SMART
EGF 4355 4388 1.18e1 SMART
EGF_like 4391 4423 6.67e1 SMART
EGF 4424 4458 1.61e0 SMART
transmembrane domain 4476 4498 N/A INTRINSIC
low complexity region 4499 4509 N/A INTRINSIC
low complexity region 4512 4523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142546
SMART Domains Protein: ENSMUSP00000117212
Gene: ENSMUSG00000049252

DomainStartEndE-ValueType
LDLa 2 30 1.76e-2 SMART
EGF 36 75 3.71e0 SMART
EGF_CA 76 113 6.8e-8 SMART
LY 188 234 4.24e0 SMART
LY 251 294 4.46e-3 SMART
LY 295 337 1.73e-9 SMART
EGF 407 440 2.45e0 SMART
EGF 448 481 2.48e-1 SMART
EGF 484 517 1.49e-4 SMART
EGF 520 553 1.69e-3 SMART
EGF 556 589 1.18e1 SMART
EGF_like 592 624 6.67e1 SMART
EGF 625 659 1.61e0 SMART
transmembrane domain 677 699 N/A INTRINSIC
low complexity region 700 710 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203015
SMART Domains Protein: ENSMUSP00000145066
Gene: ENSMUSG00000049252

DomainStartEndE-ValueType
Pfam:hEGF 12 24 1.6e-3 PFAM
EGF 28 61 8.3e-6 SMART
EGF 64 97 5.8e-2 SMART
EGF_like 100 132 3.3e-1 SMART
EGF 133 167 6.4e-3 SMART
EGF 172 205 1.9e-4 SMART
transmembrane domain 223 245 N/A INTRINSIC
low complexity region 246 256 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
Meta Mutation Damage Score 0.1224 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.1%
  • 10x: 95.9%
  • 20x: 94.1%
Validation Efficiency 99% (104/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor family. These receptors play a wide variety of roles in normal cell function and development due to their interactions with multiple ligands. Disruption of this gene has been reported in several types of cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygous null mice appear normal, are fertile, have normal brain histology and function, normal plasma cholesterol and fasting triglycerides, and do not develop tumors. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(3) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110012J17Rik T C 17: 66,448,327 D340G probably damaging Het
4930430O22Rik T C 5: 115,436,175 probably benign Het
4932438A13Rik T A 3: 37,035,945 V676D probably damaging Het
A630010A05Rik C A 16: 14,618,583 L167I possibly damaging Het
Abca14 A T 7: 120,216,182 M218L possibly damaging Het
Abca15 C A 7: 120,340,538 probably null Het
Acod1 T C 14: 103,054,567 F176L probably benign Het
Actr5 A G 2: 158,638,697 H545R probably benign Het
Adcy1 A G 11: 7,138,396 T472A probably damaging Het
AI314180 A G 4: 58,832,753 V869A probably benign Het
Aldh1l1 A G 6: 90,571,928 K469R possibly damaging Het
Ambra1 A T 2: 91,885,703 Q853L probably damaging Het
Apol7e G T 15: 77,717,766 G188V probably damaging Het
Atg7 T A 6: 114,858,982 probably benign Het
AU018091 A T 7: 3,164,259 W43R probably benign Het
Baat A G 4: 49,503,101 V7A probably benign Het
Bcas1 C A 2: 170,387,932 Q249H possibly damaging Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Brca1 A T 11: 101,531,107 probably benign Het
Btg3 A G 16: 78,364,800 probably null Het
CAAA01180111.1 C A 9: 124,295,463 V9L possibly damaging Het
Cacna2d3 T C 14: 29,333,779 N298S possibly damaging Het
Carf G A 1: 60,127,993 V127I possibly damaging Het
Catsperg1 T C 7: 29,185,008 S916G probably damaging Het
Cers1 T C 8: 70,323,169 S274P possibly damaging Het
Ces4a T A 8: 105,138,035 V48E possibly damaging Het
Clec4e G A 6: 123,285,461 probably benign Het
Cntnap5a T A 1: 115,685,168 L11* probably null Het
Cr2 C T 1: 195,157,509 G913R probably damaging Het
Cul9 A G 17: 46,525,373 L1155P probably damaging Het
D130052B06Rik C T 11: 33,623,622 probably benign Het
Dlec1 G A 9: 119,128,003 probably benign Het
Dlec1 A T 9: 119,142,578 D1278V probably damaging Het
Dmrt2 A G 19: 25,673,606 E52G possibly damaging Het
Dsp A G 13: 38,192,712 K1491R probably benign Het
Eef1d A T 15: 75,895,921 D206E probably damaging Het
Erbb2 C T 11: 98,436,175 Q1137* probably null Het
Ercc2 T A 7: 19,385,886 D157E probably benign Het
Eri1 A G 8: 35,469,130 *346Q probably null Het
Espl1 A G 15: 102,319,858 E1689G probably benign Het
Fam35a G T 14: 34,268,662 H96N possibly damaging Het
Fap C T 2: 62,517,620 V539I probably benign Het
Fasn A G 11: 120,811,040 F1871S probably benign Het
Gabpb1 T G 2: 126,652,327 Y126S probably damaging Het
Ganc A T 2: 120,430,928 probably benign Het
Gm872 T A 10: 92,969,763 H1495L probably benign Het
Gm8879 C T 5: 11,130,370 H82Y probably damaging Het
Gm9839 T A 1: 32,520,513 R163* probably null Het
Grm1 T C 10: 10,719,958 Y642C probably damaging Het
Heatr4 T C 12: 83,978,067 T327A possibly damaging Het
Hmbox1 T C 14: 64,861,578 D212G possibly damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Hoxb9 A G 11: 96,271,938 T133A probably benign Het
Insr A T 8: 3,169,720 V934E probably damaging Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itga10 C T 3: 96,652,229 Q481* probably null Het
Kifap3 T C 1: 163,829,120 probably benign Het
Kntc1 T A 5: 123,786,984 M1120K probably benign Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Lrrc38 A T 4: 143,369,880 I254F probably damaging Het
Lyrm7 A G 11: 54,850,389 F40L probably damaging Het
Mfsd4b1 C T 10: 40,002,635 S422N possibly damaging Het
Mlh3 A T 12: 85,237,600 L1380* probably null Het
Mrpl24 C A 3: 87,922,437 A110D probably benign Het
Mrps14 T C 1: 160,196,950 V17A probably benign Het
Nalcn T C 14: 123,464,656 probably benign Het
Neb T C 2: 52,230,047 Y3900C probably damaging Het
Neurod4 T C 10: 130,270,604 D267G probably benign Het
Nf1 A T 11: 79,428,626 I536F possibly damaging Het
Nkg7 C T 7: 43,437,433 P44S probably damaging Het
Olfr1200 T C 2: 88,767,488 I276V probably benign Het
Olfr293 T C 7: 86,663,977 V105A possibly damaging Het
P3h2 A T 16: 25,965,868 probably benign Het
P4ha2 A G 11: 54,106,410 probably benign Het
Pcif1 T C 2: 164,889,138 Y404H probably benign Het
Pcnx2 A T 8: 125,753,550 L2006Q possibly damaging Het
Pcnx3 A T 19: 5,674,894 S821T possibly damaging Het
Pde8b T A 13: 95,034,172 D662V probably damaging Het
Pkd1l3 C T 8: 109,616,368 P113S unknown Het
Pkd2l1 G T 19: 44,154,209 Q465K possibly damaging Het
Plch2 G T 4: 154,983,732 P1479Q probably benign Het
Plekhm3 A T 1: 64,892,882 I521N probably damaging Het
Pola2 A T 19: 5,942,065 Y526* probably null Het
Prdm14 C A 1: 13,124,532 probably benign Het
Prss23 T C 7: 89,510,009 D284G probably damaging Het
Psme2b A G 11: 48,945,640 F160S probably damaging Het
Rap1gap2 A G 11: 74,437,027 V139A possibly damaging Het
Rbbp9 G T 2: 144,543,857 R163S possibly damaging Het
Rdh12 T C 12: 79,213,748 L206P probably damaging Het
Rhou T C 8: 123,661,290 W254R possibly damaging Het
Ryr3 G T 2: 112,753,002 probably benign Het
Scfd1 A G 12: 51,431,498 K498E possibly damaging Het
Scn7a A G 2: 66,689,558 Y1001H probably benign Het
Setx T A 2: 29,158,905 V1981E probably damaging Het
Sfxn1 T C 13: 54,093,871 I205T possibly damaging Het
Slc5a2 T C 7: 128,271,256 probably benign Het
Spock1 G A 13: 57,429,369 R416C possibly damaging Het
Spred2 A G 11: 20,018,109 I222V probably benign Het
Stkld1 A T 2: 26,949,395 T358S probably benign Het
Strip1 T C 3: 107,627,408 E102G possibly damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Tdpoz1 T A 3: 93,671,330 E49V probably benign Het
Tert A G 13: 73,628,209 T360A probably benign Het
Tspear A G 10: 77,881,192 Y567C probably damaging Het
Ttc28 A G 5: 111,285,388 Q2096R probably benign Het
Ttll5 A G 12: 85,918,962 probably null Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vmn2r111 T A 17: 22,571,047 H326L probably damaging Het
Vmn2r18 A G 5: 151,586,836 F24S possibly damaging Het
Vmn2r82 A T 10: 79,396,299 I711F probably benign Het
Vwa8 C T 14: 79,103,694 Q1537* probably null Het
Wdr64 G A 1: 175,775,722 V630I probably benign Het
Wnt6 G T 1: 74,782,275 W84L probably damaging Het
Zfp11 C A 5: 129,658,190 R69L probably benign Het
Other mutations in Lrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Lrp1b APN 2 41110861 missense probably damaging 1.00
IGL00543:Lrp1b APN 2 41468948 missense possibly damaging 0.69
IGL00578:Lrp1b APN 2 40679173 missense unknown
IGL01020:Lrp1b APN 2 40998247 missense probably damaging 1.00
IGL01092:Lrp1b APN 2 40750947 missense probably damaging 0.97
IGL01155:Lrp1b APN 2 41770935 missense probably benign 0.17
IGL01361:Lrp1b APN 2 41110751 splice site probably benign
IGL01377:Lrp1b APN 2 40601538 missense probably damaging 1.00
IGL01459:Lrp1b APN 2 40860714 missense probably damaging 0.97
IGL01473:Lrp1b APN 2 40611486 missense probably damaging 0.97
IGL01528:Lrp1b APN 2 40919182 missense probably damaging 0.99
IGL01536:Lrp1b APN 2 41110883 missense probably benign 0.01
IGL01564:Lrp1b APN 2 40677486 splice site probably benign
IGL01747:Lrp1b APN 2 40860685 missense probably damaging 1.00
IGL01764:Lrp1b APN 2 40697442 missense unknown
IGL01783:Lrp1b APN 2 41312572 missense probably damaging 1.00
IGL01802:Lrp1b APN 2 41511482 missense probably benign 0.07
IGL01826:Lrp1b APN 2 41449234 missense probably damaging 1.00
IGL01884:Lrp1b APN 2 41284213 nonsense probably null
IGL01908:Lrp1b APN 2 40702804 missense probably benign
IGL01935:Lrp1b APN 2 41268355 missense probably damaging 1.00
IGL01959:Lrp1b APN 2 41312527 missense probably damaging 0.99
IGL02010:Lrp1b APN 2 41468942 missense probably damaging 1.00
IGL02022:Lrp1b APN 2 41282160 missense probably damaging 1.00
IGL02028:Lrp1b APN 2 41511452 missense probably damaging 1.00
IGL02034:Lrp1b APN 2 41268370 nonsense probably null
IGL02043:Lrp1b APN 2 40697525 missense probably null 0.44
IGL02066:Lrp1b APN 2 41111079 nonsense probably null
IGL02085:Lrp1b APN 2 40889309 missense probably benign
IGL02137:Lrp1b APN 2 40730688 splice site probably benign
IGL02218:Lrp1b APN 2 41295672 missense probably benign 0.11
IGL02409:Lrp1b APN 2 41445196 missense possibly damaging 0.93
IGL02513:Lrp1b APN 2 41110753 critical splice donor site probably null
IGL02543:Lrp1b APN 2 40870401 missense possibly damaging 0.89
IGL02701:Lrp1b APN 2 41246017 missense possibly damaging 0.50
IGL02728:Lrp1b APN 2 40801398 missense probably benign 0.03
IGL02739:Lrp1b APN 2 41498215 missense probably damaging 1.00
IGL02748:Lrp1b APN 2 40702749 missense probably damaging 0.99
IGL02754:Lrp1b APN 2 40702794 missense probably benign 0.02
IGL02797:Lrp1b APN 2 41671057 missense probably benign 0.01
IGL02813:Lrp1b APN 2 40679217 critical splice acceptor site probably null
IGL02831:Lrp1b APN 2 41193591 missense probably damaging 1.00
IGL02869:Lrp1b APN 2 40701830 missense unknown
IGL02946:Lrp1b APN 2 41312559 missense probably damaging 1.00
IGL02952:Lrp1b APN 2 41506703 missense probably benign 0.33
IGL02958:Lrp1b APN 2 41302916 missense probably damaging 1.00
IGL02977:Lrp1b APN 2 40730735 missense probably damaging 1.00
IGL03001:Lrp1b APN 2 40927889 missense probably damaging 1.00
IGL03010:Lrp1b APN 2 42323606 missense possibly damaging 0.94
IGL03060:Lrp1b APN 2 40637753 missense probably benign 0.04
IGL03129:Lrp1b APN 2 41312466 splice site probably benign
IGL03166:Lrp1b APN 2 41111038 missense probably damaging 1.00
IGL03170:Lrp1b APN 2 40697444 missense unknown
IGL03195:Lrp1b APN 2 41471122 missense possibly damaging 0.95
IGL03224:Lrp1b APN 2 41471031 missense possibly damaging 0.92
IGL03251:Lrp1b APN 2 40600267 missense probably benign 0.20
IGL03281:Lrp1b APN 2 40725514 missense probably benign 0.01
IGL03295:Lrp1b APN 2 40678987 splice site probably null
IGL03340:Lrp1b APN 2 41468969 missense probably damaging 0.97
IGL03391:Lrp1b APN 2 41295641 missense possibly damaging 0.95
IGL03401:Lrp1b APN 2 41110778 missense probably benign 0.18
IGL03403:Lrp1b APN 2 40702824 missense probably benign 0.16
IGL03408:Lrp1b APN 2 40858582 missense probably damaging 0.97
fetching UTSW 2 40879555 missense probably benign 0.00
Heiden UTSW 2 40637775 missense probably benign 0.00
hither UTSW 2 40702848 missense probably benign 0.00
Roeslein UTSW 2 40725907 missense probably damaging 1.00
I2288:Lrp1b UTSW 2 41122932 missense probably damaging 0.99
I2289:Lrp1b UTSW 2 41122932 missense probably damaging 0.99
LCD18:Lrp1b UTSW 2 42237562 intron probably benign
R0022:Lrp1b UTSW 2 40998038 splice site probably benign
R0022:Lrp1b UTSW 2 40998038 splice site probably benign
R0054:Lrp1b UTSW 2 40742817 missense probably benign 0.11
R0054:Lrp1b UTSW 2 40742817 missense probably benign 0.11
R0094:Lrp1b UTSW 2 41282030 unclassified probably benign
R0102:Lrp1b UTSW 2 41408985 splice site probably benign
R0123:Lrp1b UTSW 2 40596983 missense probably damaging 1.00
R0128:Lrp1b UTSW 2 41511508 missense probably damaging 1.00
R0130:Lrp1b UTSW 2 41511508 missense probably damaging 1.00
R0134:Lrp1b UTSW 2 40596983 missense probably damaging 1.00
R0135:Lrp1b UTSW 2 41269239 missense probably damaging 0.99
R0153:Lrp1b UTSW 2 41123019 missense possibly damaging 0.92
R0178:Lrp1b UTSW 2 40725907 missense probably damaging 1.00
R0225:Lrp1b UTSW 2 40596983 missense probably damaging 1.00
R0242:Lrp1b UTSW 2 40998183 missense probably benign 0.01
R0242:Lrp1b UTSW 2 40998183 missense probably benign 0.01
R0312:Lrp1b UTSW 2 41282171 missense probably damaging 1.00
R0325:Lrp1b UTSW 2 40851711 missense probably damaging 1.00
R0330:Lrp1b UTSW 2 40701761 nonsense probably null
R0372:Lrp1b UTSW 2 40730798 missense probably benign 0.30
R0400:Lrp1b UTSW 2 40750914 missense probably benign 0.40
R0408:Lrp1b UTSW 2 40677591 missense probably damaging 1.00
R0498:Lrp1b UTSW 2 41458405 missense probably benign 0.19
R0563:Lrp1b UTSW 2 40750914 missense probably benign 0.40
R0569:Lrp1b UTSW 2 40889239 missense probably benign 0.11
R0622:Lrp1b UTSW 2 41728551 critical splice donor site probably null
R0682:Lrp1b UTSW 2 41295641 missense probably benign 0.01
R0727:Lrp1b UTSW 2 40750944 missense probably benign 0.40
R0747:Lrp1b UTSW 2 40870341 missense probably damaging 1.00
R0761:Lrp1b UTSW 2 41185935 missense probably damaging 0.99
R0905:Lrp1b UTSW 2 41284185 missense probably damaging 1.00
R0959:Lrp1b UTSW 2 41268354 missense possibly damaging 0.83
R1124:Lrp1b UTSW 2 40875051 missense probably damaging 1.00
R1158:Lrp1b UTSW 2 40677494 missense unknown
R1265:Lrp1b UTSW 2 41476654 missense probably damaging 1.00
R1276:Lrp1b UTSW 2 41728576 missense probably benign 0.35
R1277:Lrp1b UTSW 2 40725945 missense probably benign
R1282:Lrp1b UTSW 2 40860761 missense probably damaging 1.00
R1291:Lrp1b UTSW 2 41341895 missense probably benign 0.05
R1316:Lrp1b UTSW 2 40702804 missense probably benign
R1340:Lrp1b UTSW 2 40702794 missense probably benign 0.02
R1371:Lrp1b UTSW 2 40647153 missense probably damaging 1.00
R1415:Lrp1b UTSW 2 40629664 missense probably damaging 1.00
R1416:Lrp1b UTSW 2 40998216 missense probably damaging 1.00
R1417:Lrp1b UTSW 2 41004641 missense probably benign 0.14
R1465:Lrp1b UTSW 2 41111059 missense probably benign 0.00
R1465:Lrp1b UTSW 2 41111059 missense probably benign 0.00
R1468:Lrp1b UTSW 2 40927829 critical splice donor site probably null
R1468:Lrp1b UTSW 2 40927829 critical splice donor site probably null
R1480:Lrp1b UTSW 2 40903389 missense probably damaging 1.00
R1488:Lrp1b UTSW 2 41502024 missense probably benign 0.01
R1496:Lrp1b UTSW 2 42323662 missense probably damaging 0.98
R1542:Lrp1b UTSW 2 41123712 missense probably damaging 1.00
R1571:Lrp1b UTSW 2 41476646 missense probably damaging 1.00
R1598:Lrp1b UTSW 2 41511478 missense probably damaging 1.00
R1619:Lrp1b UTSW 2 40697589 missense unknown
R1697:Lrp1b UTSW 2 40822683 missense probably damaging 0.99
R1698:Lrp1b UTSW 2 40851806 nonsense probably null
R1699:Lrp1b UTSW 2 41185962 missense possibly damaging 0.91
R1715:Lrp1b UTSW 2 41185981 missense probably damaging 1.00
R1748:Lrp1b UTSW 2 41728706 missense possibly damaging 0.56
R1756:Lrp1b UTSW 2 41110825 missense probably damaging 1.00
R1889:Lrp1b UTSW 2 40919167 nonsense probably null
R1895:Lrp1b UTSW 2 40665147 missense unknown
R1902:Lrp1b UTSW 2 40860661 missense probably damaging 1.00
R1919:Lrp1b UTSW 2 41728729 missense probably benign 0.00
R1939:Lrp1b UTSW 2 40697589 missense unknown
R1946:Lrp1b UTSW 2 40665147 missense unknown
R1954:Lrp1b UTSW 2 40858441 missense probably damaging 1.00
R1970:Lrp1b UTSW 2 40875069 missense probably damaging 1.00
R1983:Lrp1b UTSW 2 41511404 critical splice donor site probably null
R2029:Lrp1b UTSW 2 41341849 missense probably benign 0.02
R2054:Lrp1b UTSW 2 40697482 missense unknown
R2108:Lrp1b UTSW 2 41110757 missense probably damaging 1.00
R2158:Lrp1b UTSW 2 40879555 missense probably benign 0.00
R2168:Lrp1b UTSW 2 41375846 missense probably damaging 1.00
R2184:Lrp1b UTSW 2 40730702 missense probably benign
R2188:Lrp1b UTSW 2 41408959 missense probably benign 0.25
R2200:Lrp1b UTSW 2 41284165 missense probably benign 0.43
R2342:Lrp1b UTSW 2 40919196 missense possibly damaging 0.89
R2421:Lrp1b UTSW 2 40882133 splice site probably benign
R2656:Lrp1b UTSW 2 41511581 missense probably damaging 0.99
R2864:Lrp1b UTSW 2 40874995 missense possibly damaging 0.92
R2874:Lrp1b UTSW 2 40851693 missense probably damaging 1.00
R2911:Lrp1b UTSW 2 41506692 missense probably benign 0.00
R2919:Lrp1b UTSW 2 41770899 missense probably damaging 1.00
R3027:Lrp1b UTSW 2 40870271 missense probably benign 0.33
R3083:Lrp1b UTSW 2 40600324 missense probably damaging 0.99
R3545:Lrp1b UTSW 2 40600288 missense probably damaging 1.00
R3546:Lrp1b UTSW 2 40600288 missense probably damaging 1.00
R3547:Lrp1b UTSW 2 40600288 missense probably damaging 1.00
R3709:Lrp1b UTSW 2 40697442 missense unknown
R3817:Lrp1b UTSW 2 40876658 missense probably damaging 1.00
R3876:Lrp1b UTSW 2 41445194 missense probably damaging 1.00
R3877:Lrp1b UTSW 2 41445194 missense probably damaging 1.00
R3896:Lrp1b UTSW 2 40922428 splice site probably null
R3901:Lrp1b UTSW 2 40822695 missense probably damaging 1.00
R3915:Lrp1b UTSW 2 41449236 missense probably damaging 1.00
R3922:Lrp1b UTSW 2 40677581 missense unknown
R3964:Lrp1b UTSW 2 41312470 splice site probably benign
R4013:Lrp1b UTSW 2 40802984 missense possibly damaging 0.66
R4014:Lrp1b UTSW 2 40802984 missense possibly damaging 0.66
R4015:Lrp1b UTSW 2 40802984 missense possibly damaging 0.66
R4017:Lrp1b UTSW 2 40802984 missense possibly damaging 0.66
R4031:Lrp1b UTSW 2 40702848 missense probably benign 0.00
R4095:Lrp1b UTSW 2 41449191 missense probably benign 0.03
R4108:Lrp1b UTSW 2 40665087 missense unknown
R4176:Lrp1b UTSW 2 41408393 missense probably damaging 1.00
R4181:Lrp1b UTSW 2 40611434 missense probably damaging 1.00
R4359:Lrp1b UTSW 2 40903065 missense probably damaging 1.00
R4410:Lrp1b UTSW 2 40665082 missense possibly damaging 0.96
R4416:Lrp1b UTSW 2 40663667 missense unknown
R4489:Lrp1b UTSW 2 40661489 unclassified probably benign
R4577:Lrp1b UTSW 2 40821719 missense probably damaging 1.00
R4623:Lrp1b UTSW 2 41246021 missense probably damaging 1.00
R4677:Lrp1b UTSW 2 40801484 missense probably damaging 1.00
R4684:Lrp1b UTSW 2 40922304 missense probably benign 0.44
R4714:Lrp1b UTSW 2 41110759 missense possibly damaging 0.90
R4721:Lrp1b UTSW 2 40715369 splice site probably null
R4755:Lrp1b UTSW 2 41269273 missense probably benign 0.07
R4755:Lrp1b UTSW 2 41471016 missense probably benign
R4774:Lrp1b UTSW 2 40661532 missense probably null 1.00
R4854:Lrp1b UTSW 2 41111077 missense probably damaging 1.00
R4880:Lrp1b UTSW 2 41770919 missense probably benign 0.07
R4885:Lrp1b UTSW 2 41468893 missense probably benign
R4901:Lrp1b UTSW 2 40821645 missense probably damaging 1.00
R4919:Lrp1b UTSW 2 40647234 missense probably benign 0.25
R4935:Lrp1b UTSW 2 41498393 missense probably benign 0.01
R4937:Lrp1b UTSW 2 40802885 splice site probably null
R4967:Lrp1b UTSW 2 41788974 missense probably damaging 1.00
R4968:Lrp1b UTSW 2 40702707 splice site probably null
R4968:Lrp1b UTSW 2 41789062 missense probably damaging 1.00
R5155:Lrp1b UTSW 2 41728622 intron probably null
R5221:Lrp1b UTSW 2 41112982 missense possibly damaging 0.79
R5224:Lrp1b UTSW 2 41110840 missense possibly damaging 0.61
R5227:Lrp1b UTSW 2 40851793 missense possibly damaging 0.95
R5246:Lrp1b UTSW 2 41470940 critical splice donor site probably null
R5263:Lrp1b UTSW 2 41960679 missense probably damaging 1.00
R5274:Lrp1b UTSW 2 41344444 missense probably null 1.00
R5291:Lrp1b UTSW 2 40903003 missense probably damaging 1.00
R5362:Lrp1b UTSW 2 41375902 missense probably damaging 1.00
R5365:Lrp1b UTSW 2 40647125 missense possibly damaging 0.55
R5369:Lrp1b UTSW 2 41004613 nonsense probably null
R5419:Lrp1b UTSW 2 40730704 nonsense probably null
R5434:Lrp1b UTSW 2 41770868 missense probably damaging 0.96
R5452:Lrp1b UTSW 2 40922316 missense probably damaging 1.00
R5453:Lrp1b UTSW 2 41282237 missense probably damaging 1.00
R5496:Lrp1b UTSW 2 40927973 missense probably benign 0.02
R5524:Lrp1b UTSW 2 41110888 missense probably damaging 1.00
R5538:Lrp1b UTSW 2 40697474 missense unknown
R5571:Lrp1b UTSW 2 41408342 missense probably damaging 0.97
R5577:Lrp1b UTSW 2 40875123 missense possibly damaging 0.70
R5609:Lrp1b UTSW 2 41341795 missense probably damaging 1.00
R5635:Lrp1b UTSW 2 42652822 utr 5 prime probably benign
R5669:Lrp1b UTSW 2 41111038 missense probably damaging 1.00
R5672:Lrp1b UTSW 2 41341759 missense probably benign 0.01
R5690:Lrp1b UTSW 2 40750894 splice site probably null
R5752:Lrp1b UTSW 2 41295612 missense probably damaging 1.00
R5853:Lrp1b UTSW 2 40663726 missense unknown
R5869:Lrp1b UTSW 2 41004603 missense probably damaging 0.98
R5880:Lrp1b UTSW 2 41341814 missense probably benign 0.23
R5887:Lrp1b UTSW 2 40821707 missense possibly damaging 0.91
R5893:Lrp1b UTSW 2 40601587 missense probably damaging 1.00
R5894:Lrp1b UTSW 2 41498221 missense probably benign 0.11
R6019:Lrp1b UTSW 2 41302970 missense probably damaging 1.00
R6019:Lrp1b UTSW 2 41476809 missense probably damaging 1.00
R6021:Lrp1b UTSW 2 41344427 missense probably benign 0.02
R6045:Lrp1b UTSW 2 40701813 missense unknown
R6047:Lrp1b UTSW 2 40637775 missense probably benign 0.00
R6060:Lrp1b UTSW 2 40750934 missense probably benign 0.09
R6063:Lrp1b UTSW 2 41284144 nonsense probably null
R6090:Lrp1b UTSW 2 41185868 critical splice donor site probably null
R6112:Lrp1b UTSW 2 41341882 missense probably benign 0.14
R6128:Lrp1b UTSW 2 40860655 missense probably benign
R6149:Lrp1b UTSW 2 40875153 splice site probably null
R6174:Lrp1b UTSW 2 41449263 missense probably benign
R6177:Lrp1b UTSW 2 41123736 splice site probably null
R6257:Lrp1b UTSW 2 40596969 unclassified probably null
R6267:Lrp1b UTSW 2 40657525 missense probably benign 0.00
R6268:Lrp1b UTSW 2 40821717 missense probably benign 0.01
R6331:Lrp1b UTSW 2 40803209 missense probably damaging 1.00
R6334:Lrp1b UTSW 2 41789033 missense probably benign
R6359:Lrp1b UTSW 2 41295596 missense probably damaging 1.00
R6371:Lrp1b UTSW 2 40851654 missense possibly damaging 0.61
R6421:Lrp1b UTSW 2 40889270 missense probably damaging 1.00
R6524:Lrp1b UTSW 2 40851804 missense possibly damaging 0.95
R6616:Lrp1b UTSW 2 40699631 missense unknown
R6632:Lrp1b UTSW 2 40725442 missense probably benign 0.23
R6656:Lrp1b UTSW 2 40637864 nonsense probably null
R6698:Lrp1b UTSW 2 41302946 missense probably damaging 1.00
R6741:Lrp1b UTSW 2 41245989 missense possibly damaging 0.82
R6742:Lrp1b UTSW 2 41471120 missense probably benign 0.31
R6811:Lrp1b UTSW 2 40715500 splice site probably null
R6811:Lrp1b UTSW 2 41449194 missense probably benign 0.01
R6855:Lrp1b UTSW 2 40628696 missense possibly damaging 0.66
R6888:Lrp1b UTSW 2 41471126 missense probably benign 0.18
R6946:Lrp1b UTSW 2 40697439 missense probably benign
R6984:Lrp1b UTSW 2 40822628 missense probably damaging 0.97
V1662:Lrp1b UTSW 2 41122932 missense probably damaging 0.99
X0028:Lrp1b UTSW 2 41471145 missense probably damaging 1.00
X0064:Lrp1b UTSW 2 41502043 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTCCACAGGTACATGCTAATCCATA -3'
(R):5'- ACATTGACCCACTTAGGAAAAGTGACG -3'

Sequencing Primer
(F):5'- TGCTAATCCATATTAGTGTATGTTGC -3'
(R):5'- AGGGTGATCTGAGATGTCACTG -3'
Posted On2014-05-23