Incidental Mutation 'R0083:Fbxw10'
ID19768
Institutional Source Beutler Lab
Gene Symbol Fbxw10
Ensembl Gene ENSMUSG00000090173
Gene NameF-box and WD-40 domain protein 10
SynonymsSM2SH2, SM25H2, Fbw10
MMRRC Submission 038370-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0083 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location62847069-62877465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62877061 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 903 (T903A)
Ref Sequence ENSEMBL: ENSMUSP00000117872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014321] [ENSMUST00000036085] [ENSMUST00000150989] [ENSMUST00000176577] [ENSMUST00000177336]
Predicted Effect probably benign
Transcript: ENSMUST00000014321
SMART Domains Protein: ENSMUSP00000014321
Gene: ENSMUSG00000014177

DomainStartEndE-ValueType
Pfam:DUF846 32 174 9.5e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036085
AA Change: T913A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046156
Gene: ENSMUSG00000090173
AA Change: T913A

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 6e-14 BLAST
Blast:WD40 416 453 2e-8 BLAST
WD40 457 496 1.78e-5 SMART
WD40 499 536 5.55e-7 SMART
WD40 539 575 2.84e-4 SMART
WD40 578 615 3.81e-5 SMART
WD40 620 656 6.9e-1 SMART
low complexity region 709 724 N/A INTRINSIC
coiled coil region 964 992 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128698
Predicted Effect probably benign
Transcript: ENSMUST00000150989
AA Change: T903A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117872
Gene: ENSMUSG00000090173
AA Change: T903A

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 1e-13 BLAST
Blast:WD40 406 443 2e-8 BLAST
WD40 447 486 1.78e-5 SMART
WD40 489 526 5.55e-7 SMART
WD40 529 565 2.84e-4 SMART
WD40 568 605 3.81e-5 SMART
WD40 610 646 6.9e-1 SMART
low complexity region 699 714 N/A INTRINSIC
coiled coil region 954 982 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154176
Predicted Effect probably benign
Transcript: ENSMUST00000176577
AA Change: T908A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135870
Gene: ENSMUSG00000090173
AA Change: T908A

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 6e-14 BLAST
Blast:WD40 406 443 2e-8 BLAST
WD40 447 486 1.78e-5 SMART
WD40 489 526 5.55e-7 SMART
WD40 529 565 2.84e-4 SMART
WD40 568 605 3.81e-5 SMART
WD40 610 646 6.9e-1 SMART
low complexity region 704 719 N/A INTRINSIC
coiled coil region 959 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177336
SMART Domains Protein: ENSMUSP00000135294
Gene: ENSMUSG00000090173

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 5e-14 BLAST
Blast:WD40 406 443 1e-8 BLAST
WD40 447 486 1.78e-5 SMART
WD40 489 526 5.55e-7 SMART
WD40 529 565 2.84e-4 SMART
WD40 568 605 3.81e-5 SMART
WD40 610 646 6.9e-1 SMART
Meta Mutation Damage Score 0.0836 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 83.1%
Validation Efficiency 88% (117/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXW10, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,494,132 F283L possibly damaging Het
4930562C15Rik A T 16: 4,849,542 I266F unknown Het
Adam39 T G 8: 40,825,078 F169V probably damaging Het
Adcy2 A T 13: 68,651,935 V858E probably damaging Het
Adgrv1 A G 13: 81,578,404 probably benign Het
Ankrd26 G T 6: 118,523,254 H1085Q probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atg4c C T 4: 99,221,440 H215Y possibly damaging Het
Atp6v0d2 G A 4: 19,880,001 probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
C1qtnf3 G A 15: 10,975,632 V175I possibly damaging Het
Cacna1c A G 6: 118,625,523 M1293T probably damaging Het
Ccdc88a T A 11: 29,503,463 S337T probably damaging Het
Cntn4 A G 6: 106,525,369 I362M possibly damaging Het
Col22a1 A T 15: 71,890,497 D104E possibly damaging Het
Col4a4 T C 1: 82,507,111 probably null Het
Cul7 C A 17: 46,655,556 R304S probably benign Het
Elfn2 A T 15: 78,673,414 L311Q probably damaging Het
Esrrb T C 12: 86,514,452 L320P probably damaging Het
Fkbp4 G A 6: 128,432,407 probably benign Het
Gatad2b T A 3: 90,357,943 Y576N probably damaging Het
Greb1 T C 12: 16,696,451 M1273V probably benign Het
Helq C A 5: 100,768,368 E913* probably null Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Ints13 A G 6: 146,550,664 Y686H probably benign Het
Itgb7 C T 15: 102,223,482 R222H probably damaging Het
Krt81 A G 15: 101,463,465 I78T probably damaging Het
Lonp2 G A 8: 86,716,355 V815I probably benign Het
Mctp2 G T 7: 72,228,516 F271L possibly damaging Het
Mrto4 C T 4: 139,347,968 V175I possibly damaging Het
Myh14 A G 7: 44,634,519 V654A probably damaging Het
Neu2 A G 1: 87,597,262 Y323C probably damaging Het
Nt5dc1 A C 10: 34,403,764 M94R probably damaging Het
Nup210l A G 3: 90,189,575 T1364A probably damaging Het
Obscn T C 11: 59,022,374 D6939G probably damaging Het
Olfr1491 A T 19: 13,705,678 T284S probably damaging Het
Pias4 A G 10: 81,164,166 S18P probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Plk5 G A 10: 80,356,662 G34S possibly damaging Het
Ptprj A T 2: 90,469,777 probably null Het
Rps6ka2 G A 17: 7,296,043 D617N probably benign Het
Sap130 C A 18: 31,666,329 probably benign Het
Sap130 C T 18: 31,711,641 P902S probably damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Sel1l3 C T 5: 53,137,902 A786T possibly damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc15a2 T C 16: 36,782,283 Y72C probably damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slc30a5 G T 13: 100,803,400 A669E probably damaging Het
Sppl2c G A 11: 104,186,532 V53I probably benign Het
Sstr1 T A 12: 58,213,742 C384S possibly damaging Het
Sulf1 A G 1: 12,817,417 M272V probably damaging Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Tmem94 A G 11: 115,796,724 probably benign Het
Topaz1 A T 9: 122,775,609 I1093L probably benign Het
Ttll4 G T 1: 74,679,769 V260L probably benign Het
Vmn2r26 A T 6: 124,053,981 probably null Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp939 A T 7: 39,474,110 noncoding transcript Het
Other mutations in Fbxw10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Fbxw10 APN 11 62873501 missense probably damaging 1.00
IGL01552:Fbxw10 APN 11 62857684 critical splice acceptor site probably null
IGL01625:Fbxw10 APN 11 62860027 missense probably damaging 1.00
IGL01960:Fbxw10 APN 11 62876756 missense probably damaging 1.00
IGL02457:Fbxw10 APN 11 62874982 missense probably damaging 1.00
IGL02475:Fbxw10 APN 11 62857735 missense possibly damaging 0.94
IGL02864:Fbxw10 APN 11 62873523 missense probably damaging 1.00
R0108:Fbxw10 UTSW 11 62877061 missense probably benign 0.00
R0147:Fbxw10 UTSW 11 62847481 unclassified probably null
R0180:Fbxw10 UTSW 11 62853096 missense probably benign 0.09
R0196:Fbxw10 UTSW 11 62877244 missense probably benign 0.01
R0454:Fbxw10 UTSW 11 62876738 missense possibly damaging 0.53
R0529:Fbxw10 UTSW 11 62859845 missense probably damaging 1.00
R0791:Fbxw10 UTSW 11 62847456 missense probably benign 0.18
R0927:Fbxw10 UTSW 11 62876944 missense probably damaging 0.98
R1026:Fbxw10 UTSW 11 62875171 missense probably benign
R1448:Fbxw10 UTSW 11 62847592 missense possibly damaging 0.74
R1468:Fbxw10 UTSW 11 62862638 missense probably damaging 1.00
R1468:Fbxw10 UTSW 11 62862638 missense probably damaging 1.00
R1689:Fbxw10 UTSW 11 62860036 missense probably damaging 1.00
R1785:Fbxw10 UTSW 11 62859857 missense probably damaging 0.99
R2130:Fbxw10 UTSW 11 62859857 missense probably damaging 0.99
R2132:Fbxw10 UTSW 11 62859857 missense probably damaging 0.99
R2211:Fbxw10 UTSW 11 62867535 missense probably damaging 0.99
R3078:Fbxw10 UTSW 11 62867513 splice site probably benign
R3700:Fbxw10 UTSW 11 62869157 splice site probably null
R3932:Fbxw10 UTSW 11 62869157 splice site probably benign
R4843:Fbxw10 UTSW 11 62847325 missense possibly damaging 0.95
R4869:Fbxw10 UTSW 11 62862731 missense probably damaging 0.98
R4879:Fbxw10 UTSW 11 62847747 missense probably damaging 0.99
R4980:Fbxw10 UTSW 11 62847757 missense possibly damaging 0.94
R5417:Fbxw10 UTSW 11 62877164 missense possibly damaging 0.53
R5531:Fbxw10 UTSW 11 62862656 missense probably damaging 1.00
R5877:Fbxw10 UTSW 11 62857716 missense probably damaging 1.00
R6028:Fbxw10 UTSW 11 62873519 nonsense probably null
R6616:Fbxw10 UTSW 11 62853024 missense probably benign 0.14
R6870:Fbxw10 UTSW 11 62855367 missense probably damaging 0.99
R6967:Fbxw10 UTSW 11 62847603 missense possibly damaging 0.73
R7409:Fbxw10 UTSW 11 62876780 missense possibly damaging 0.86
R7464:Fbxw10 UTSW 11 62853298 missense probably benign 0.01
R7542:Fbxw10 UTSW 11 62850596 missense probably benign 0.33
R7568:Fbxw10 UTSW 11 62875168 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCCACAATTCTGAAGAGTTTGCC -3'
(R):5'- TCCTTCACAGTCATCAGCATGAACC -3'

Sequencing Primer
(F):5'- CAATCTTCCTACAGGTGTGAGAC -3'
(R):5'- GAACCCAGTGTTCATTCTCAGAG -3'
Posted On2013-04-11