Incidental Mutation 'R1468:Fermt1'
Institutional Source Beutler Lab
Gene Symbol Fermt1
Ensembl Gene ENSMUSG00000027356
Gene Namefermitin family member 1
SynonymsKindlin-1, 5830467P10Rik
MMRRC Submission 039521-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1468 (G1)
Quality Score225
Status Validated
Chromosomal Location132904389-132945906 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 132925022 bp
Amino Acid Change Glutamic Acid to Lysine at position 342 (E342K)
Ref Sequence ENSEMBL: ENSMUSP00000047616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038280]
PDB Structure
Solution Structure of the N-terminal domain of kindlin-1 [SOLUTION NMR]
Structural and functional characterisation of the kindlin-1 pleckstrin homology domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000038280
AA Change: E342K

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000047616
Gene: ENSMUSG00000027356
AA Change: E342K

Blast:B41 10 74 2e-16 BLAST
B41 91 570 1.39e-30 SMART
PH 370 475 2.81e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134937
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fermitin family, and contains a FERM domain and a pleckstrin homology domain. The encoded protein is involved in integrin signaling and linkage of the actin cytoskeleton to the extracellular matrix. Mutations in this gene have been linked to Kindler syndrome. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality within 5 days of birth, dehydration, detachment of colonic epithelial cells, and colonic inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T G 7: 12,512,580 M1R probably null Het
4933440N22Rik C A 6: 117,907,579 probably benign Het
5031439G07Rik G T 15: 84,953,144 P280T probably damaging Het
Abca2 C T 2: 25,441,296 S1267L probably damaging Het
Acsl3 A T 1: 78,706,409 R719S probably benign Het
Adam1a A T 5: 121,519,776 probably null Het
Adamts7 T C 9: 90,188,798 probably benign Het
Adgrf3 G A 5: 30,202,229 probably benign Het
Aldh6a1 T C 12: 84,441,770 E89G possibly damaging Het
Ankrd36 A G 11: 5,575,752 Y238C probably damaging Het
Ankrd65 G A 4: 155,792,905 R291Q probably benign Het
Ano2 C T 6: 125,796,264 R287W probably damaging Het
Ap1ar A G 3: 127,812,566 I125T probably benign Het
Arid1b A G 17: 5,242,922 D705G probably damaging Het
Asb18 T A 1: 89,996,283 N86I probably damaging Het
Bicral A T 17: 46,824,593 S564T probably benign Het
Bpifa6 A G 2: 153,989,272 M253V probably benign Het
Braf T C 6: 39,665,083 D194G probably damaging Het
Brinp3 C A 1: 146,901,962 P716T probably benign Het
C7 T A 15: 5,012,149 Y425F probably damaging Het
Ccdc102a T C 8: 94,906,086 K421R probably benign Het
Cep89 G A 7: 35,420,963 probably null Het
Chgb A T 2: 132,792,800 M221L probably benign Het
Chst14 A G 2: 118,927,664 Y313C probably damaging Het
Ciita G A 16: 10,513,288 probably null Het
Clec12b A T 6: 129,380,640 I85N probably damaging Het
Clec2e G T 6: 129,093,496 Y187* probably null Het
Crbn T C 6: 106,790,843 K229E probably benign Het
Ctdspl2 A T 2: 121,981,281 Q201L probably benign Het
Ctrb1 G T 8: 111,689,409 probably benign Het
Cyp2c55 T A 19: 39,011,081 V77E probably damaging Het
Cyp2c69 A C 19: 39,849,395 D414E probably damaging Het
Ddx47 T C 6: 135,011,740 probably benign Het
Dlg1 A G 16: 31,842,822 probably null Het
Dnah5 C A 15: 28,230,463 S169* probably null Het
Dock4 C A 12: 40,755,810 T927K probably benign Het
Esrp2 T G 8: 106,133,821 D259A probably damaging Het
Fam169a A G 13: 97,118,530 K418R probably benign Het
Fam207a A G 10: 77,497,526 probably benign Het
Fancm A T 12: 65,099,293 I597F probably damaging Het
Fastkd2 G T 1: 63,732,226 probably benign Het
Fat1 G A 8: 45,010,545 V1375M probably damaging Het
Fbxw10 A T 11: 62,862,638 D486V probably damaging Het
Fech C T 18: 64,470,673 probably benign Het
Foxp1 T A 6: 98,978,220 H195L possibly damaging Het
Gfra1 T A 19: 58,451,975 I138L probably benign Het
Gm12185 T C 11: 48,915,674 D230G possibly damaging Het
Gm14403 T A 2: 177,507,231 probably benign Het
Gpd2 A C 2: 57,355,774 T439P probably damaging Het
Gpm6a A T 8: 55,037,350 K20N probably damaging Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hectd4 A T 5: 121,349,172 D3410V possibly damaging Het
Il17b G A 18: 61,690,412 probably null Het
Irx4 G T 13: 73,265,576 R55L possibly damaging Het
Itgav A T 2: 83,765,901 probably benign Het
Lama3 T C 18: 12,441,107 V582A probably benign Het
Ldhd G T 8: 111,627,293 A425E possibly damaging Het
Lrp1b C T 2: 40,927,829 probably null Het
Lrp5 T C 19: 3,620,191 T638A possibly damaging Het
Lrrk1 A C 7: 66,259,974 F1996C probably damaging Het
Ly6h G A 15: 75,566,137 S21L probably benign Het
Mctp1 T C 13: 76,825,273 V431A probably benign Het
Metap2 C T 10: 93,871,483 probably null Het
Mfsd2b T A 12: 4,870,536 K94* probably null Het
Micall2 A G 5: 139,719,342 L79P probably damaging Het
Mucl2 T C 15: 103,897,407 T95A possibly damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Myo5b G T 18: 74,740,503 V1467L probably damaging Het
Nfic G T 10: 81,420,580 D105E probably damaging Het
Nrd1 T A 4: 109,016,668 F227Y probably benign Het
Nrp2 A T 1: 62,738,299 I88F probably damaging Het
Nup160 A T 2: 90,700,543 H515L probably benign Het
Nup205 G A 6: 35,225,982 probably null Het
Oas1g G A 5: 120,882,006 T179I probably benign Het
Ogfr A T 2: 180,594,750 E376V probably damaging Het
Olfr1212 T G 2: 88,959,043 Y192* probably null Het
Olfr1241 A T 2: 89,482,511 V208D possibly damaging Het
Olfr166 T G 16: 19,487,628 S263R probably benign Het
Olfr478 C T 7: 108,032,388 probably null Het
Olfr646 G T 7: 104,106,689 V137F possibly damaging Het
Pard3b T C 1: 62,345,029 V851A probably benign Het
Pcdhb16 A T 18: 37,478,089 Y34F probably damaging Het
Pikfyve T C 1: 65,251,666 Y1215H probably damaging Het
Pkhd1 A T 1: 20,523,341 V1516E probably damaging Het
Pla2g4a A T 1: 149,887,593 probably benign Het
Ptprg A T 14: 12,190,767 I818F probably benign Het
Ralgapb A G 2: 158,462,253 E644G possibly damaging Het
Rbm45 A G 2: 76,372,115 I127M probably damaging Het
Rtp2 T C 16: 23,927,470 Y157C probably damaging Het
Sema3f A T 9: 107,687,572 probably benign Het
Sf3b3 A T 8: 110,837,374 Y329N probably damaging Het
Sfxn1 A G 13: 54,085,627 probably null Het
Shkbp1 A T 7: 27,345,326 C447S probably damaging Het
Sipa1l3 A G 7: 29,322,260 S689P possibly damaging Het
Slc7a8 A G 14: 54,733,199 S332P probably damaging Het
Slit1 C A 19: 41,608,384 C1092F probably damaging Het
Stard9 A G 2: 120,703,197 I619V possibly damaging Het
Sycp3 T C 10: 88,469,592 V185A possibly damaging Het
Taar9 A T 10: 24,109,484 N17K possibly damaging Het
Tbkbp1 T C 11: 97,148,988 E102G probably damaging Het
Tex44 A G 1: 86,427,112 N248D probably benign Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Tnpo1 C T 13: 98,850,157 V781I probably benign Het
Tonsl C T 15: 76,636,561 probably null Het
Ttc6 A G 12: 57,674,677 K984R possibly damaging Het
Usp34 A G 11: 23,441,171 E2263G probably damaging Het
Usp8 A G 2: 126,754,927 K875E probably damaging Het
Vapb C T 2: 173,762,112 probably benign Het
Vmn1r223 A G 13: 23,249,868 I211V possibly damaging Het
Vmn2r81 G A 10: 79,293,662 V796I probably damaging Het
Wdr90 A T 17: 25,854,053 V856D probably damaging Het
Wnk2 T A 13: 49,082,095 T615S probably damaging Het
Other mutations in Fermt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02391:Fermt1 APN 2 132941951 missense probably damaging 1.00
IGL02511:Fermt1 APN 2 132933166 splice site probably benign
IGL02591:Fermt1 APN 2 132934866 missense possibly damaging 0.89
IGL03107:Fermt1 APN 2 132933139 missense probably damaging 1.00
R0691:Fermt1 UTSW 2 132906733 missense probably damaging 0.99
R1386:Fermt1 UTSW 2 132916058 missense probably damaging 0.99
R1468:Fermt1 UTSW 2 132925022 missense probably benign 0.16
R1474:Fermt1 UTSW 2 132925022 missense probably benign 0.16
R1510:Fermt1 UTSW 2 132925022 missense probably benign 0.16
R1558:Fermt1 UTSW 2 132934819 critical splice donor site probably null
R1625:Fermt1 UTSW 2 132922831 missense probably damaging 1.00
R1917:Fermt1 UTSW 2 132922842 missense probably damaging 1.00
R2026:Fermt1 UTSW 2 132918525 missense probably benign 0.11
R2264:Fermt1 UTSW 2 132915190 critical splice donor site probably null
R2512:Fermt1 UTSW 2 132939518 splice site probably null
R3765:Fermt1 UTSW 2 132906702 missense possibly damaging 0.55
R4914:Fermt1 UTSW 2 132906840 missense probably damaging 1.00
R5184:Fermt1 UTSW 2 132941963 missense possibly damaging 0.50
R5259:Fermt1 UTSW 2 132906765 missense probably damaging 0.99
R5303:Fermt1 UTSW 2 132911339 intron probably null
R5304:Fermt1 UTSW 2 132942066 missense probably benign 0.00
R5404:Fermt1 UTSW 2 132934869 missense possibly damaging 0.55
R5569:Fermt1 UTSW 2 132915203 missense possibly damaging 0.89
X0013:Fermt1 UTSW 2 132918586 missense probably damaging 0.96
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gtagagcacacctgtaatccc -3'
Posted On2014-05-23