Incidental Mutation 'R1468:Sf3b3'
ID197727
Institutional Source Beutler Lab
Gene Symbol Sf3b3
Ensembl Gene ENSMUSG00000033732
Gene Namesplicing factor 3b, subunit 3
Synonyms5730409A01Rik, 1810061H24Rik, D8Ertd633e, SAP130, RSE1
MMRRC Submission 039521-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.974) question?
Stock #R1468 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location110810239-110846787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110837374 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 329 (Y329N)
Ref Sequence ENSEMBL: ENSMUSP00000045073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042012]
Predicted Effect probably damaging
Transcript: ENSMUST00000042012
AA Change: Y329N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045073
Gene: ENSMUSG00000033732
AA Change: Y329N

DomainStartEndE-ValueType
Blast:SH3 17 70 5e-13 BLAST
Pfam:MMS1_N 76 592 3.2e-185 PFAM
low complexity region 716 728 N/A INTRINSIC
Pfam:CPSF_A 863 1184 4.3e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212613
Meta Mutation Damage Score 0.4 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 3 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. Subunit 3 has also been identified as a component of the STAGA (SPT3-TAF(II)31-GCN5L acetylase) transcription coactivator-HAT (histone acetyltransferase) complex, and the TFTC (TATA-binding-protein-free TAF(II)-containing complex). These complexes may function in chromatin modification, transcription, splicing, and DNA repair. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T G 7: 12,512,580 M1R probably null Het
4933440N22Rik C A 6: 117,907,579 probably benign Het
5031439G07Rik G T 15: 84,953,144 P280T probably damaging Het
Abca2 C T 2: 25,441,296 S1267L probably damaging Het
Acsl3 A T 1: 78,706,409 R719S probably benign Het
Adam1a A T 5: 121,519,776 probably null Het
Adamts7 T C 9: 90,188,798 probably benign Het
Adgrf3 G A 5: 30,202,229 probably benign Het
Aldh6a1 T C 12: 84,441,770 E89G possibly damaging Het
Ankrd36 A G 11: 5,575,752 Y238C probably damaging Het
Ankrd65 G A 4: 155,792,905 R291Q probably benign Het
Ano2 C T 6: 125,796,264 R287W probably damaging Het
Ap1ar A G 3: 127,812,566 I125T probably benign Het
Arid1b A G 17: 5,242,922 D705G probably damaging Het
Asb18 T A 1: 89,996,283 N86I probably damaging Het
Bicral A T 17: 46,824,593 S564T probably benign Het
Bpifa6 A G 2: 153,989,272 M253V probably benign Het
Braf T C 6: 39,665,083 D194G probably damaging Het
Brinp3 C A 1: 146,901,962 P716T probably benign Het
C7 T A 15: 5,012,149 Y425F probably damaging Het
Ccdc102a T C 8: 94,906,086 K421R probably benign Het
Cep89 G A 7: 35,420,963 probably null Het
Chgb A T 2: 132,792,800 M221L probably benign Het
Chst14 A G 2: 118,927,664 Y313C probably damaging Het
Ciita G A 16: 10,513,288 probably null Het
Clec12b A T 6: 129,380,640 I85N probably damaging Het
Clec2e G T 6: 129,093,496 Y187* probably null Het
Crbn T C 6: 106,790,843 K229E probably benign Het
Ctdspl2 A T 2: 121,981,281 Q201L probably benign Het
Ctrb1 G T 8: 111,689,409 probably benign Het
Cyp2c55 T A 19: 39,011,081 V77E probably damaging Het
Cyp2c69 A C 19: 39,849,395 D414E probably damaging Het
Ddx47 T C 6: 135,011,740 probably benign Het
Dlg1 A G 16: 31,842,822 probably null Het
Dnah5 C A 15: 28,230,463 S169* probably null Het
Dock4 C A 12: 40,755,810 T927K probably benign Het
Esrp2 T G 8: 106,133,821 D259A probably damaging Het
Fam169a A G 13: 97,118,530 K418R probably benign Het
Fam207a A G 10: 77,497,526 probably benign Het
Fancm A T 12: 65,099,293 I597F probably damaging Het
Fastkd2 G T 1: 63,732,226 probably benign Het
Fat1 G A 8: 45,010,545 V1375M probably damaging Het
Fbxw10 A T 11: 62,862,638 D486V probably damaging Het
Fech C T 18: 64,470,673 probably benign Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxp1 T A 6: 98,978,220 H195L possibly damaging Het
Gfra1 T A 19: 58,451,975 I138L probably benign Het
Gm12185 T C 11: 48,915,674 D230G possibly damaging Het
Gm14403 T A 2: 177,507,231 probably benign Het
Gpd2 A C 2: 57,355,774 T439P probably damaging Het
Gpm6a A T 8: 55,037,350 K20N probably damaging Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hectd4 A T 5: 121,349,172 D3410V possibly damaging Het
Il17b G A 18: 61,690,412 probably null Het
Irx4 G T 13: 73,265,576 R55L possibly damaging Het
Itgav A T 2: 83,765,901 probably benign Het
Lama3 T C 18: 12,441,107 V582A probably benign Het
Ldhd G T 8: 111,627,293 A425E possibly damaging Het
Lrp1b C T 2: 40,927,829 probably null Het
Lrp5 T C 19: 3,620,191 T638A possibly damaging Het
Lrrk1 A C 7: 66,259,974 F1996C probably damaging Het
Ly6h G A 15: 75,566,137 S21L probably benign Het
Mctp1 T C 13: 76,825,273 V431A probably benign Het
Metap2 C T 10: 93,871,483 probably null Het
Mfsd2b T A 12: 4,870,536 K94* probably null Het
Micall2 A G 5: 139,719,342 L79P probably damaging Het
Mucl2 T C 15: 103,897,407 T95A possibly damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Myo5b G T 18: 74,740,503 V1467L probably damaging Het
Nfic G T 10: 81,420,580 D105E probably damaging Het
Nrd1 T A 4: 109,016,668 F227Y probably benign Het
Nrp2 A T 1: 62,738,299 I88F probably damaging Het
Nup160 A T 2: 90,700,543 H515L probably benign Het
Nup205 G A 6: 35,225,982 probably null Het
Oas1g G A 5: 120,882,006 T179I probably benign Het
Ogfr A T 2: 180,594,750 E376V probably damaging Het
Olfr1212 T G 2: 88,959,043 Y192* probably null Het
Olfr1241 A T 2: 89,482,511 V208D possibly damaging Het
Olfr166 T G 16: 19,487,628 S263R probably benign Het
Olfr478 C T 7: 108,032,388 probably null Het
Olfr646 G T 7: 104,106,689 V137F possibly damaging Het
Pard3b T C 1: 62,345,029 V851A probably benign Het
Pcdhb16 A T 18: 37,478,089 Y34F probably damaging Het
Pikfyve T C 1: 65,251,666 Y1215H probably damaging Het
Pkhd1 A T 1: 20,523,341 V1516E probably damaging Het
Pla2g4a A T 1: 149,887,593 probably benign Het
Ptprg A T 14: 12,190,767 I818F probably benign Het
Ralgapb A G 2: 158,462,253 E644G possibly damaging Het
Rbm45 A G 2: 76,372,115 I127M probably damaging Het
Rtp2 T C 16: 23,927,470 Y157C probably damaging Het
Sema3f A T 9: 107,687,572 probably benign Het
Sfxn1 A G 13: 54,085,627 probably null Het
Shkbp1 A T 7: 27,345,326 C447S probably damaging Het
Sipa1l3 A G 7: 29,322,260 S689P possibly damaging Het
Slc7a8 A G 14: 54,733,199 S332P probably damaging Het
Slit1 C A 19: 41,608,384 C1092F probably damaging Het
Stard9 A G 2: 120,703,197 I619V possibly damaging Het
Sycp3 T C 10: 88,469,592 V185A possibly damaging Het
Taar9 A T 10: 24,109,484 N17K possibly damaging Het
Tbkbp1 T C 11: 97,148,988 E102G probably damaging Het
Tex44 A G 1: 86,427,112 N248D probably benign Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Tnpo1 C T 13: 98,850,157 V781I probably benign Het
Tonsl C T 15: 76,636,561 probably null Het
Ttc6 A G 12: 57,674,677 K984R possibly damaging Het
Usp34 A G 11: 23,441,171 E2263G probably damaging Het
Usp8 A G 2: 126,754,927 K875E probably damaging Het
Vapb C T 2: 173,762,112 probably benign Het
Vmn1r223 A G 13: 23,249,868 I211V possibly damaging Het
Vmn2r81 G A 10: 79,293,662 V796I probably damaging Het
Wdr90 A T 17: 25,854,053 V856D probably damaging Het
Wnk2 T A 13: 49,082,095 T615S probably damaging Het
Other mutations in Sf3b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Sf3b3 APN 8 110813751 nonsense probably null
IGL00770:Sf3b3 APN 8 110817638 missense probably damaging 0.96
IGL00774:Sf3b3 APN 8 110817638 missense probably damaging 0.96
IGL01132:Sf3b3 APN 8 110842781 missense probably benign
IGL01487:Sf3b3 APN 8 110817660 missense probably benign 0.01
IGL02015:Sf3b3 APN 8 110816290 missense possibly damaging 0.82
IGL02126:Sf3b3 APN 8 110823443 missense probably benign
IGL02612:Sf3b3 APN 8 110842976 missense probably benign
IGL02833:Sf3b3 APN 8 110811977 critical splice donor site probably null
IGL03033:Sf3b3 APN 8 110810964 missense possibly damaging 0.62
IGL03366:Sf3b3 APN 8 110839954 missense probably damaging 1.00
R0458:Sf3b3 UTSW 8 110812136 splice site probably benign
R0907:Sf3b3 UTSW 8 110811510 splice site probably benign
R1344:Sf3b3 UTSW 8 110838303 missense probably damaging 0.98
R1468:Sf3b3 UTSW 8 110837374 missense probably damaging 1.00
R1736:Sf3b3 UTSW 8 110813832 missense probably benign
R1833:Sf3b3 UTSW 8 110817566 missense probably benign
R2225:Sf3b3 UTSW 8 110814573 missense probably damaging 1.00
R3236:Sf3b3 UTSW 8 110812020 missense probably damaging 0.99
R3615:Sf3b3 UTSW 8 110844523 missense probably damaging 1.00
R3616:Sf3b3 UTSW 8 110844523 missense probably damaging 1.00
R3683:Sf3b3 UTSW 8 110813621 critical splice donor site probably null
R4197:Sf3b3 UTSW 8 110821565 missense probably damaging 0.98
R4429:Sf3b3 UTSW 8 110826118 missense probably benign 0.01
R4674:Sf3b3 UTSW 8 110844505 missense probably damaging 0.99
R4895:Sf3b3 UTSW 8 110816024 missense probably benign 0.00
R4931:Sf3b3 UTSW 8 110816329 missense probably benign 0.00
R4948:Sf3b3 UTSW 8 110813669 missense probably damaging 0.99
R4999:Sf3b3 UTSW 8 110841203 missense probably benign 0.34
R5150:Sf3b3 UTSW 8 110823376 missense possibly damaging 0.88
R5175:Sf3b3 UTSW 8 110833835 missense probably benign
R5559:Sf3b3 UTSW 8 110838215 missense probably benign 0.00
R5866:Sf3b3 UTSW 8 110814634 missense probably benign
R5934:Sf3b3 UTSW 8 110823470 missense probably damaging 0.99
R6270:Sf3b3 UTSW 8 110841820 missense probably damaging 1.00
R6803:Sf3b3 UTSW 8 110825578 missense probably benign 0.01
X0024:Sf3b3 UTSW 8 110842932 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GACATTCAGGGTAGTAACTGAAGCCAC -3'
(R):5'- TGTAGGCTCAGTCTGAAGTAGCCG -3'

Sequencing Primer
(F):5'- cctcccctgactttctacac -3'
(R):5'- TCAGTCTGAAGTAGCCGACATTG -3'
Posted On2014-05-23