Incidental Mutation 'R1468:Fancm'
ID197747
Institutional Source Beutler Lab
Gene Symbol Fancm
Ensembl Gene ENSMUSG00000055884
Gene NameFanconi anemia, complementation group M
SynonymsD12Ertd364e, C730036B14Rik
MMRRC Submission 039521-MU
Accession Numbers

Ncbi RefSeq: NM_178912.3; MGI:2442306

Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R1468 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location65075603-65132058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65099293 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 597 (I597F)
Ref Sequence ENSEMBL: ENSMUSP00000054797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058889] [ENSMUST00000222540]
Predicted Effect probably damaging
Transcript: ENSMUST00000058889
AA Change: I597F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000054797
Gene: ENSMUSG00000055884
AA Change: I597F

DomainStartEndE-ValueType
DEXDc 75 275 5.6e-25 SMART
Blast:DEXDc 295 323 9e-6 BLAST
low complexity region 339 348 N/A INTRINSIC
HELICc 475 566 5.64e-21 SMART
Pfam:FANCM-MHF_bd 657 770 8.5e-50 PFAM
low complexity region 850 866 N/A INTRINSIC
low complexity region 974 987 N/A INTRINSIC
low complexity region 1105 1120 N/A INTRINSIC
low complexity region 1165 1178 N/A INTRINSIC
PDB:4DAY|C 1207 1238 1e-6 PDB
low complexity region 1489 1506 N/A INTRINSIC
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 1669 1682 N/A INTRINSIC
ERCC4 1780 1863 2.07e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222521
Predicted Effect probably damaging
Transcript: ENSMUST00000222540
AA Change: I597F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223401
Meta Mutation Damage Score 0.266 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 98% (106/108)
MGI Phenotype Strain: 4355560
Lethality: D500-D600
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group M. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female transmission, hypogonadism, premature death, and increased incidence of tumors. [provided by MGI curators]
Allele List at MGI

All alleles(39) : Targeted(4) Gene trapped(35)

Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T G 7: 12,512,580 M1R probably null Het
4933440N22Rik C A 6: 117,907,579 probably benign Het
5031439G07Rik G T 15: 84,953,144 P280T probably damaging Het
Abca2 C T 2: 25,441,296 S1267L probably damaging Het
Acsl3 A T 1: 78,706,409 R719S probably benign Het
Adam1a A T 5: 121,519,776 probably null Het
Adamts7 T C 9: 90,188,798 probably benign Het
Adgrf3 G A 5: 30,202,229 probably benign Het
Aldh6a1 T C 12: 84,441,770 E89G possibly damaging Het
Ankrd36 A G 11: 5,575,752 Y238C probably damaging Het
Ankrd65 G A 4: 155,792,905 R291Q probably benign Het
Ano2 C T 6: 125,796,264 R287W probably damaging Het
Ap1ar A G 3: 127,812,566 I125T probably benign Het
Arid1b A G 17: 5,242,922 D705G probably damaging Het
Asb18 T A 1: 89,996,283 N86I probably damaging Het
Bicral A T 17: 46,824,593 S564T probably benign Het
Bpifa6 A G 2: 153,989,272 M253V probably benign Het
Braf T C 6: 39,665,083 D194G probably damaging Het
Brinp3 C A 1: 146,901,962 P716T probably benign Het
C7 T A 15: 5,012,149 Y425F probably damaging Het
Ccdc102a T C 8: 94,906,086 K421R probably benign Het
Cep89 G A 7: 35,420,963 probably null Het
Chgb A T 2: 132,792,800 M221L probably benign Het
Chst14 A G 2: 118,927,664 Y313C probably damaging Het
Ciita G A 16: 10,513,288 probably null Het
Clec12b A T 6: 129,380,640 I85N probably damaging Het
Clec2e G T 6: 129,093,496 Y187* probably null Het
Crbn T C 6: 106,790,843 K229E probably benign Het
Ctdspl2 A T 2: 121,981,281 Q201L probably benign Het
Ctrb1 G T 8: 111,689,409 probably benign Het
Cyp2c55 T A 19: 39,011,081 V77E probably damaging Het
Cyp2c69 A C 19: 39,849,395 D414E probably damaging Het
Ddx47 T C 6: 135,011,740 probably benign Het
Dlg1 A G 16: 31,842,822 probably null Het
Dnah5 C A 15: 28,230,463 S169* probably null Het
Dock4 C A 12: 40,755,810 T927K probably benign Het
Esrp2 T G 8: 106,133,821 D259A probably damaging Het
Fam169a A G 13: 97,118,530 K418R probably benign Het
Fam207a A G 10: 77,497,526 probably benign Het
Fastkd2 G T 1: 63,732,226 probably benign Het
Fat1 G A 8: 45,010,545 V1375M probably damaging Het
Fbxw10 A T 11: 62,862,638 D486V probably damaging Het
Fech C T 18: 64,470,673 probably benign Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxp1 T A 6: 98,978,220 H195L possibly damaging Het
Gfra1 T A 19: 58,451,975 I138L probably benign Het
Gm12185 T C 11: 48,915,674 D230G possibly damaging Het
Gm14403 T A 2: 177,507,231 probably benign Het
Gpd2 A C 2: 57,355,774 T439P probably damaging Het
Gpm6a A T 8: 55,037,350 K20N probably damaging Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hectd4 A T 5: 121,349,172 D3410V possibly damaging Het
Il17b G A 18: 61,690,412 probably null Het
Irx4 G T 13: 73,265,576 R55L possibly damaging Het
Itgav A T 2: 83,765,901 probably benign Het
Lama3 T C 18: 12,441,107 V582A probably benign Het
Ldhd G T 8: 111,627,293 A425E possibly damaging Het
Lrp1b C T 2: 40,927,829 probably null Het
Lrp5 T C 19: 3,620,191 T638A possibly damaging Het
Lrrk1 A C 7: 66,259,974 F1996C probably damaging Het
Ly6h G A 15: 75,566,137 S21L probably benign Het
Mctp1 T C 13: 76,825,273 V431A probably benign Het
Metap2 C T 10: 93,871,483 probably null Het
Mfsd2b T A 12: 4,870,536 K94* probably null Het
Micall2 A G 5: 139,719,342 L79P probably damaging Het
Mucl2 T C 15: 103,897,407 T95A possibly damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Myo5b G T 18: 74,740,503 V1467L probably damaging Het
Nfic G T 10: 81,420,580 D105E probably damaging Het
Nrd1 T A 4: 109,016,668 F227Y probably benign Het
Nrp2 A T 1: 62,738,299 I88F probably damaging Het
Nup160 A T 2: 90,700,543 H515L probably benign Het
Nup205 G A 6: 35,225,982 probably null Het
Oas1g G A 5: 120,882,006 T179I probably benign Het
Ogfr A T 2: 180,594,750 E376V probably damaging Het
Olfr1212 T G 2: 88,959,043 Y192* probably null Het
Olfr1241 A T 2: 89,482,511 V208D possibly damaging Het
Olfr166 T G 16: 19,487,628 S263R probably benign Het
Olfr478 C T 7: 108,032,388 probably null Het
Olfr646 G T 7: 104,106,689 V137F possibly damaging Het
Pard3b T C 1: 62,345,029 V851A probably benign Het
Pcdhb16 A T 18: 37,478,089 Y34F probably damaging Het
Pikfyve T C 1: 65,251,666 Y1215H probably damaging Het
Pkhd1 A T 1: 20,523,341 V1516E probably damaging Het
Pla2g4a A T 1: 149,887,593 probably benign Het
Ptprg A T 14: 12,190,767 I818F probably benign Het
Ralgapb A G 2: 158,462,253 E644G possibly damaging Het
Rbm45 A G 2: 76,372,115 I127M probably damaging Het
Rtp2 T C 16: 23,927,470 Y157C probably damaging Het
Sema3f A T 9: 107,687,572 probably benign Het
Sf3b3 A T 8: 110,837,374 Y329N probably damaging Het
Sfxn1 A G 13: 54,085,627 probably null Het
Shkbp1 A T 7: 27,345,326 C447S probably damaging Het
Sipa1l3 A G 7: 29,322,260 S689P possibly damaging Het
Slc7a8 A G 14: 54,733,199 S332P probably damaging Het
Slit1 C A 19: 41,608,384 C1092F probably damaging Het
Stard9 A G 2: 120,703,197 I619V possibly damaging Het
Sycp3 T C 10: 88,469,592 V185A possibly damaging Het
Taar9 A T 10: 24,109,484 N17K possibly damaging Het
Tbkbp1 T C 11: 97,148,988 E102G probably damaging Het
Tex44 A G 1: 86,427,112 N248D probably benign Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Tnpo1 C T 13: 98,850,157 V781I probably benign Het
Tonsl C T 15: 76,636,561 probably null Het
Ttc6 A G 12: 57,674,677 K984R possibly damaging Het
Usp34 A G 11: 23,441,171 E2263G probably damaging Het
Usp8 A G 2: 126,754,927 K875E probably damaging Het
Vapb C T 2: 173,762,112 probably benign Het
Vmn1r223 A G 13: 23,249,868 I211V possibly damaging Het
Vmn2r81 G A 10: 79,293,662 V796I probably damaging Het
Wdr90 A T 17: 25,854,053 V856D probably damaging Het
Wnk2 T A 13: 49,082,095 T615S probably damaging Het
Other mutations in Fancm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Fancm APN 12 65075736 missense possibly damaging 0.50
IGL00489:Fancm APN 12 65106193 missense probably benign 0.01
IGL00529:Fancm APN 12 65130417 utr 3 prime probably benign
IGL00898:Fancm APN 12 65106000 missense probably benign 0.01
IGL01805:Fancm APN 12 65113861 critical splice donor site probably null
IGL01986:Fancm APN 12 65126655 nonsense probably null
IGL02026:Fancm APN 12 65105734 missense probably benign 0.03
IGL02069:Fancm APN 12 65075911 missense probably benign 0.05
IGL02103:Fancm APN 12 65095784 missense probably benign 0.38
IGL02133:Fancm APN 12 65106475 missense probably benign 0.04
IGL02400:Fancm APN 12 65113815 missense probably damaging 1.00
IGL02478:Fancm APN 12 65077090 missense probably damaging 1.00
IGL02479:Fancm APN 12 65106485 missense probably damaging 0.98
IGL02563:Fancm APN 12 65092462 missense probably damaging 1.00
IGL02606:Fancm APN 12 65076139 missense possibly damaging 0.90
IGL02731:Fancm APN 12 65088305 missense probably benign 0.00
IGL02809:Fancm APN 12 65121667 missense possibly damaging 0.54
IGL02953:Fancm APN 12 65121966 missense probably benign 0.27
IGL03066:Fancm APN 12 65125114 nonsense probably null
IGL03073:Fancm APN 12 65101632 missense probably damaging 1.00
PIT4131001:Fancm UTSW 12 65105422 missense probably benign 0.03
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0125:Fancm UTSW 12 65121956 missense possibly damaging 0.68
R0201:Fancm UTSW 12 65101632 missense probably damaging 1.00
R0360:Fancm UTSW 12 65075950 missense probably damaging 1.00
R0491:Fancm UTSW 12 65106061 missense probably benign 0.32
R0557:Fancm UTSW 12 65118442 critical splice donor site probably null
R0617:Fancm UTSW 12 65097317 nonsense probably null
R1201:Fancm UTSW 12 65106768 missense possibly damaging 0.66
R1353:Fancm UTSW 12 65088170 missense probably damaging 1.00
R1456:Fancm UTSW 12 65118351 missense possibly damaging 0.48
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1521:Fancm UTSW 12 65121704 missense probably benign 0.25
R1530:Fancm UTSW 12 65092490 critical splice donor site probably null
R1559:Fancm UTSW 12 65093689 missense probably benign 0.00
R1632:Fancm UTSW 12 65130331 missense probably damaging 1.00
R1681:Fancm UTSW 12 65105656 missense probably benign 0.03
R1919:Fancm UTSW 12 65105520 missense possibly damaging 0.48
R1969:Fancm UTSW 12 65101692 missense probably benign 0.09
R1971:Fancm UTSW 12 65101692 missense probably benign 0.09
R2117:Fancm UTSW 12 65077174 missense probably damaging 1.00
R2510:Fancm UTSW 12 65113770 splice site probably benign
R2909:Fancm UTSW 12 65124856 missense probably damaging 1.00
R3155:Fancm UTSW 12 65116421 missense probably benign 0.32
R3405:Fancm UTSW 12 65075772 missense probably benign 0.00
R4133:Fancm UTSW 12 65120530 missense probably benign 0.44
R4308:Fancm UTSW 12 65126531 missense probably benign 0.14
R4588:Fancm UTSW 12 65118441 critical splice donor site probably null
R4602:Fancm UTSW 12 65124944 missense probably benign 0.12
R4653:Fancm UTSW 12 65083054 missense probably damaging 0.99
R4702:Fancm UTSW 12 65122052 missense possibly damaging 0.95
R4719:Fancm UTSW 12 65121706 missense possibly damaging 0.64
R4885:Fancm UTSW 12 65102643 nonsense probably null
R4896:Fancm UTSW 12 65075831 missense probably damaging 1.00
R4908:Fancm UTSW 12 65094871 missense probably benign 0.28
R4921:Fancm UTSW 12 65077141 missense probably benign 0.19
R4922:Fancm UTSW 12 65106892 critical splice donor site probably null
R4948:Fancm UTSW 12 65090974 missense probably damaging 1.00
R5103:Fancm UTSW 12 65105858 missense probably damaging 0.99
R5577:Fancm UTSW 12 65130411 utr 3 prime probably benign
R5631:Fancm UTSW 12 65113843 missense probably damaging 0.97
R5741:Fancm UTSW 12 65101615 missense probably benign 0.01
R6137:Fancm UTSW 12 65130382 missense probably damaging 1.00
R6167:Fancm UTSW 12 65094895 missense probably benign 0.42
R6242:Fancm UTSW 12 65116442 missense probably benign 0.01
R6242:Fancm UTSW 12 65116449 missense probably benign 0.00
R6281:Fancm UTSW 12 65088270 missense probably damaging 1.00
R6325:Fancm UTSW 12 65125052 missense probably damaging 1.00
R6434:Fancm UTSW 12 65077168 missense probably damaging 1.00
R6493:Fancm UTSW 12 65097488 missense probably benign 0.04
R6542:Fancm UTSW 12 65097429 missense probably damaging 1.00
R6645:Fancm UTSW 12 65106100 missense probably damaging 0.99
R6878:Fancm UTSW 12 65116423 nonsense probably null
R7171:Fancm UTSW 12 65101620 missense probably damaging 0.99
R7172:Fancm UTSW 12 65106054 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTGTATCATCCAGTCAGCCCATGC -3'
(R):5'- AAACGGCCTTCGCTGTACACTC -3'

Sequencing Primer
(F):5'- CCATGCCAAACAGTGTTGAG -3'
(R):5'- TCGCTGTACACTCCGAGC -3'
Posted On2014-05-23