Incidental Mutation 'R0083:Sap130'
ID19784
Institutional Source Beutler Lab
Gene Symbol Sap130
Ensembl Gene ENSMUSG00000024260
Gene NameSin3A associated protein
Synonyms2610304F09Rik
MMRRC Submission 038370-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.844) question?
Stock #R0083 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location31634371-31723061 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 31666329 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025109] [ENSMUST00000178164]
Predicted Effect probably benign
Transcript: ENSMUST00000025109
SMART Domains Protein: ENSMUSP00000025109
Gene: ENSMUSG00000024260

DomainStartEndE-ValueType
low complexity region 82 107 N/A INTRINSIC
low complexity region 115 124 N/A INTRINSIC
low complexity region 347 356 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
low complexity region 577 588 N/A INTRINSIC
low complexity region 716 748 N/A INTRINSIC
low complexity region 751 770 N/A INTRINSIC
low complexity region 817 832 N/A INTRINSIC
low complexity region 894 904 N/A INTRINSIC
low complexity region 1044 1056 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178164
SMART Domains Protein: ENSMUSP00000136842
Gene: ENSMUSG00000024260

DomainStartEndE-ValueType
low complexity region 82 107 N/A INTRINSIC
low complexity region 115 124 N/A INTRINSIC
low complexity region 347 356 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
low complexity region 577 588 N/A INTRINSIC
Pfam:SAP130_C 635 1040 5.4e-224 PFAM
low complexity region 1045 1057 N/A INTRINSIC
Meta Mutation Damage Score 0.1292 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 83.1%
Validation Efficiency 88% (117/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SAP130 is a subunit of the histone deacetylase (see HDAC1; MIM 601241)-dependent SIN3A (MIM 607776) corepressor complex (Fleischer et al., 2003 [PubMed 12724404]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a transposon insertion are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,494,132 F283L possibly damaging Het
4930562C15Rik A T 16: 4,849,542 I266F unknown Het
Adam39 T G 8: 40,825,078 F169V probably damaging Het
Adcy2 A T 13: 68,651,935 V858E probably damaging Het
Adgrv1 A G 13: 81,578,404 probably benign Het
Ankrd26 G T 6: 118,523,254 H1085Q probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atg4c C T 4: 99,221,440 H215Y possibly damaging Het
Atp6v0d2 G A 4: 19,880,001 probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
C1qtnf3 G A 15: 10,975,632 V175I possibly damaging Het
Cacna1c A G 6: 118,625,523 M1293T probably damaging Het
Ccdc88a T A 11: 29,503,463 S337T probably damaging Het
Cntn4 A G 6: 106,525,369 I362M possibly damaging Het
Col22a1 A T 15: 71,890,497 D104E possibly damaging Het
Col4a4 T C 1: 82,507,111 probably null Het
Cul7 C A 17: 46,655,556 R304S probably benign Het
Elfn2 A T 15: 78,673,414 L311Q probably damaging Het
Esrrb T C 12: 86,514,452 L320P probably damaging Het
Fbxw10 A G 11: 62,877,061 T903A probably benign Het
Fkbp4 G A 6: 128,432,407 probably benign Het
Gatad2b T A 3: 90,357,943 Y576N probably damaging Het
Greb1 T C 12: 16,696,451 M1273V probably benign Het
Helq C A 5: 100,768,368 E913* probably null Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Ints13 A G 6: 146,550,664 Y686H probably benign Het
Itgb7 C T 15: 102,223,482 R222H probably damaging Het
Krt81 A G 15: 101,463,465 I78T probably damaging Het
Lonp2 G A 8: 86,716,355 V815I probably benign Het
Mctp2 G T 7: 72,228,516 F271L possibly damaging Het
Mrto4 C T 4: 139,347,968 V175I possibly damaging Het
Myh14 A G 7: 44,634,519 V654A probably damaging Het
Neu2 A G 1: 87,597,262 Y323C probably damaging Het
Nt5dc1 A C 10: 34,403,764 M94R probably damaging Het
Nup210l A G 3: 90,189,575 T1364A probably damaging Het
Obscn T C 11: 59,022,374 D6939G probably damaging Het
Olfr1491 A T 19: 13,705,678 T284S probably damaging Het
Pias4 A G 10: 81,164,166 S18P probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Plk5 G A 10: 80,356,662 G34S possibly damaging Het
Ptprj A T 2: 90,469,777 probably null Het
Rps6ka2 G A 17: 7,296,043 D617N probably benign Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Sel1l3 C T 5: 53,137,902 A786T possibly damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc15a2 T C 16: 36,782,283 Y72C probably damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slc30a5 G T 13: 100,803,400 A669E probably damaging Het
Sppl2c G A 11: 104,186,532 V53I probably benign Het
Sstr1 T A 12: 58,213,742 C384S possibly damaging Het
Sulf1 A G 1: 12,817,417 M272V probably damaging Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Tmem94 A G 11: 115,796,724 probably benign Het
Topaz1 A T 9: 122,775,609 I1093L probably benign Het
Ttll4 G T 1: 74,679,769 V260L probably benign Het
Vmn2r26 A T 6: 124,053,981 probably null Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp939 A T 7: 39,474,110 noncoding transcript Het
Other mutations in Sap130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Sap130 APN 18 31698766 missense probably benign 0.00
IGL01060:Sap130 APN 18 31715443 missense probably damaging 1.00
IGL01668:Sap130 APN 18 31680440 missense probably damaging 0.97
IGL01797:Sap130 APN 18 31698668 missense probably damaging 0.98
IGL01872:Sap130 APN 18 31674420 missense probably damaging 0.98
IGL02010:Sap130 APN 18 31649602 missense probably damaging 0.98
PIT4142001:Sap130 UTSW 18 31667011 critical splice donor site probably null
PIT4366001:Sap130 UTSW 18 31677409 missense probably benign 0.06
R0083:Sap130 UTSW 18 31711641 missense probably damaging 1.00
R0243:Sap130 UTSW 18 31680681 splice site probably benign
R0255:Sap130 UTSW 18 31680506 missense probably damaging 1.00
R0704:Sap130 UTSW 18 31653554 missense probably damaging 0.99
R1069:Sap130 UTSW 18 31711629 missense probably damaging 0.96
R1086:Sap130 UTSW 18 31650620 splice site probably benign
R1162:Sap130 UTSW 18 31648173 missense probably damaging 1.00
R1478:Sap130 UTSW 18 31680474 missense possibly damaging 0.95
R1484:Sap130 UTSW 18 31711327 missense probably damaging 1.00
R1554:Sap130 UTSW 18 31666472 missense probably damaging 0.99
R1625:Sap130 UTSW 18 31674464 missense probably damaging 0.99
R1771:Sap130 UTSW 18 31636082 missense probably benign 0.10
R1793:Sap130 UTSW 18 31698587 missense probably benign 0.10
R1905:Sap130 UTSW 18 31680567 missense possibly damaging 0.67
R2026:Sap130 UTSW 18 31698574 missense possibly damaging 0.81
R2074:Sap130 UTSW 18 31648279 missense probably damaging 0.99
R2174:Sap130 UTSW 18 31677479 critical splice donor site probably null
R3927:Sap130 UTSW 18 31674382 missense possibly damaging 0.95
R4454:Sap130 UTSW 18 31711360 missense probably damaging 1.00
R4980:Sap130 UTSW 18 31649646 missense possibly damaging 0.95
R5222:Sap130 UTSW 18 31666703 missense probably damaging 1.00
R5345:Sap130 UTSW 18 31648198 missense probably benign 0.32
R5811:Sap130 UTSW 18 31689442 missense probably benign 0.01
R6034:Sap130 UTSW 18 31689406 missense possibly damaging 0.92
R6034:Sap130 UTSW 18 31689406 missense possibly damaging 0.92
R6038:Sap130 UTSW 18 31680486 missense probably damaging 0.99
R6038:Sap130 UTSW 18 31680486 missense probably damaging 0.99
R6129:Sap130 UTSW 18 31682091 missense possibly damaging 0.94
R6431:Sap130 UTSW 18 31666365 missense possibly damaging 0.95
R6930:Sap130 UTSW 18 31682088 missense possibly damaging 0.94
R6932:Sap130 UTSW 18 31666354 missense possibly damaging 0.88
X0021:Sap130 UTSW 18 31647076 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTTGAAGCAAGATGGCAACCAGC -3'
(R):5'- TTCTGTGAGGGGACCCCATAACAC -3'

Sequencing Primer
(F):5'- GATGGCAACCAGCCACAAG -3'
(R):5'- GCAGGCCCTTTATCAAGTCAG -3'
Posted On2013-04-11