Incidental Mutation 'R0083:Olfr1491'
ID19785
Institutional Source Beutler Lab
Gene Symbol Olfr1491
Ensembl Gene ENSMUSG00000051156
Gene Nameolfactory receptor 1491
SynonymsGA_x6K02T2RE5P-4037809-4038768, MOR266-8
MMRRC Submission 038370-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0083 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13697268-13706127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13705678 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 284 (T284S)
Ref Sequence ENSEMBL: ENSMUSP00000149884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052737] [ENSMUST00000214007] [ENSMUST00000215493] [ENSMUST00000216366] [ENSMUST00000216377] [ENSMUST00000216622]
Predicted Effect probably damaging
Transcript: ENSMUST00000052737
AA Change: T284S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057902
Gene: ENSMUSG00000051156
AA Change: T284S

DomainStartEndE-ValueType
Pfam:7tm_4 35 314 3.3e-52 PFAM
Pfam:7tm_1 45 295 5.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214007
AA Change: T284S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000215493
AA Change: T284S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216366
AA Change: T284S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216377
AA Change: T284S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216622
AA Change: T284S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.0364 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 83.1%
Validation Efficiency 88% (117/133)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,494,132 F283L possibly damaging Het
4930562C15Rik A T 16: 4,849,542 I266F unknown Het
Adam39 T G 8: 40,825,078 F169V probably damaging Het
Adcy2 A T 13: 68,651,935 V858E probably damaging Het
Adgrv1 A G 13: 81,578,404 probably benign Het
Ankrd26 G T 6: 118,523,254 H1085Q probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atg4c C T 4: 99,221,440 H215Y possibly damaging Het
Atp6v0d2 G A 4: 19,880,001 probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
C1qtnf3 G A 15: 10,975,632 V175I possibly damaging Het
Cacna1c A G 6: 118,625,523 M1293T probably damaging Het
Ccdc88a T A 11: 29,503,463 S337T probably damaging Het
Cntn4 A G 6: 106,525,369 I362M possibly damaging Het
Col22a1 A T 15: 71,890,497 D104E possibly damaging Het
Col4a4 T C 1: 82,507,111 probably null Het
Cul7 C A 17: 46,655,556 R304S probably benign Het
Elfn2 A T 15: 78,673,414 L311Q probably damaging Het
Esrrb T C 12: 86,514,452 L320P probably damaging Het
Fbxw10 A G 11: 62,877,061 T903A probably benign Het
Fkbp4 G A 6: 128,432,407 probably benign Het
Gatad2b T A 3: 90,357,943 Y576N probably damaging Het
Greb1 T C 12: 16,696,451 M1273V probably benign Het
Helq C A 5: 100,768,368 E913* probably null Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Ints13 A G 6: 146,550,664 Y686H probably benign Het
Itgb7 C T 15: 102,223,482 R222H probably damaging Het
Krt81 A G 15: 101,463,465 I78T probably damaging Het
Lonp2 G A 8: 86,716,355 V815I probably benign Het
Mctp2 G T 7: 72,228,516 F271L possibly damaging Het
Mrto4 C T 4: 139,347,968 V175I possibly damaging Het
Myh14 A G 7: 44,634,519 V654A probably damaging Het
Neu2 A G 1: 87,597,262 Y323C probably damaging Het
Nt5dc1 A C 10: 34,403,764 M94R probably damaging Het
Nup210l A G 3: 90,189,575 T1364A probably damaging Het
Obscn T C 11: 59,022,374 D6939G probably damaging Het
Pias4 A G 10: 81,164,166 S18P probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Plk5 G A 10: 80,356,662 G34S possibly damaging Het
Ptprj A T 2: 90,469,777 probably null Het
Rps6ka2 G A 17: 7,296,043 D617N probably benign Het
Sap130 C A 18: 31,666,329 probably benign Het
Sap130 C T 18: 31,711,641 P902S probably damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Sel1l3 C T 5: 53,137,902 A786T possibly damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc15a2 T C 16: 36,782,283 Y72C probably damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slc30a5 G T 13: 100,803,400 A669E probably damaging Het
Sppl2c G A 11: 104,186,532 V53I probably benign Het
Sstr1 T A 12: 58,213,742 C384S possibly damaging Het
Sulf1 A G 1: 12,817,417 M272V probably damaging Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Tmem94 A G 11: 115,796,724 probably benign Het
Topaz1 A T 9: 122,775,609 I1093L probably benign Het
Ttll4 G T 1: 74,679,769 V260L probably benign Het
Vmn2r26 A T 6: 124,053,981 probably null Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp939 A T 7: 39,474,110 noncoding transcript Het
Other mutations in Olfr1491
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Olfr1491 APN 19 13705732 missense probably benign 0.05
IGL02713:Olfr1491 APN 19 13705189 missense possibly damaging 0.78
IGL02822:Olfr1491 APN 19 13705655 missense probably benign 0.13
R0108:Olfr1491 UTSW 19 13705678 missense probably damaging 0.99
R0271:Olfr1491 UTSW 19 13705135 missense probably benign 0.03
R1364:Olfr1491 UTSW 19 13705445 missense probably benign 0.11
R1538:Olfr1491 UTSW 19 13705496 missense probably damaging 1.00
R1575:Olfr1491 UTSW 19 13705525 missense probably benign 0.00
R1579:Olfr1491 UTSW 19 13705202 missense probably damaging 1.00
R2179:Olfr1491 UTSW 19 13705394 missense probably damaging 0.98
R4393:Olfr1491 UTSW 19 13705190 missense possibly damaging 0.50
R5837:Olfr1491 UTSW 19 13704960 nonsense probably null
R6001:Olfr1491 UTSW 19 13705060 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTTCTGTGGACATTACCTGGAA -3'
(R):5'- AGTTCCTCAGAGCACCTTTGACA -3'

Posted On2013-04-11