Incidental Mutation 'R1470:Ikbke'
ID197892
Institutional Source Beutler Lab
Gene Symbol Ikbke
Ensembl Gene ENSMUSG00000042349
Gene Nameinhibitor of kappaB kinase epsilon
SynonymsIKK-i, IKKepsilon
MMRRC Submission 039523-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1470 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location131254343-131279606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131276487 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 23 (V23E)
Ref Sequence ENSEMBL: ENSMUSP00000124486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062108] [ENSMUST00000159195] [ENSMUST00000161764]
Predicted Effect probably null
Transcript: ENSMUST00000062108
AA Change: V23E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054126
Gene: ENSMUSG00000042349
AA Change: V23E

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 249 1.1e-29 PFAM
Pfam:Pkinase 9 301 6.7e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159195
AA Change: V23E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124486
Gene: ENSMUSG00000042349
AA Change: V23E

DomainStartEndE-ValueType
Pfam:Pkinase 9 130 2.2e-23 PFAM
Pfam:Pkinase_Tyr 9 130 2.1e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161764
AA Change: V23E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124190
Gene: ENSMUSG00000042349
AA Change: V23E

DomainStartEndE-ValueType
Pfam:Pkinase 49 278 9.3e-31 PFAM
Pfam:Pkinase_Tyr 50 226 5.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162285
Meta Mutation Damage Score 0.556 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 97% (125/129)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IKBKE is a noncanonical I-kappa-B (see MIM 164008) kinase (IKK) that is essential for regulating antiviral signaling pathways. IKBKE has also been identified as a breast cancer (MIM 114480) oncogene and is amplified and overexpressed in over 30% of breast carcinomas and breast cancer cell lines (Hutti et al., 2009 [PubMed 19481526]).[supplied by OMIM, Oct 2009]
PHENOTYPE: Homozygous null mice are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 142 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik T C 15: 98,585,261 probably benign Het
4932438A13Rik T C 3: 36,998,331 M3060T probably benign Het
Aak1 T A 6: 86,967,355 S749T unknown Het
Abcb4 A T 5: 8,940,968 I843F probably damaging Het
Abcb6 A T 1: 75,172,679 probably benign Het
AC161516.2 G T 5: 67,946,397 probably benign Het
AC238840.1 A T 7: 38,767,953 noncoding transcript Het
Actr8 T A 14: 29,986,969 H244Q possibly damaging Het
Acyp2 A G 11: 30,506,452 probably benign Het
Adgrv1 A G 13: 81,382,298 Y5886H probably benign Het
Afap1 C T 5: 35,961,737 probably benign Het
Agk T A 6: 40,386,817 W244R probably damaging Het
Akirin1 T A 4: 123,738,090 probably benign Het
Ankrd11 C A 8: 122,899,724 V161L probably damaging Het
Arap3 T C 18: 37,989,196 probably null Het
Arhgap29 A G 3: 121,992,319 probably benign Het
Armc3 A G 2: 19,238,736 M88V probably benign Het
Atp13a5 G T 16: 29,349,015 P109T probably benign Het
Avpr1b T A 1: 131,600,585 V282D probably damaging Het
Baz2b T C 2: 59,978,546 K120E possibly damaging Het
Cacna1a T A 8: 84,514,950 probably benign Het
Cacng6 G A 7: 3,424,888 C76Y probably damaging Het
Cactin G T 10: 81,323,151 E279* probably null Het
Car9 A G 4: 43,510,222 Y268C probably damaging Het
Ccdc146 T A 5: 21,319,566 I263F probably damaging Het
Cdc16 A T 8: 13,758,992 probably benign Het
Cdh16 T G 8: 104,618,371 S429R probably benign Het
Cep250 A G 2: 155,991,075 E1639G probably damaging Het
Ces1d A T 8: 93,195,021 V38D possibly damaging Het
Chd1 A T 17: 15,726,283 Q97L possibly damaging Het
Ciita G A 16: 10,514,468 D898N possibly damaging Het
Clstn1 A G 4: 149,634,722 N336S possibly damaging Het
Cntnap5a A G 1: 116,259,519 D607G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col20a1 C T 2: 180,994,960 H245Y probably benign Het
Coq8b A T 7: 27,252,309 T399S probably benign Het
Cpn2 A G 16: 30,260,185 S233P probably benign Het
Cryz G A 3: 154,606,476 G70D probably damaging Het
Csmd1 G T 8: 16,157,204 probably benign Het
Def6 T A 17: 28,225,982 D451E possibly damaging Het
Dnah8 T A 17: 30,747,277 C2480* probably null Het
Dnah9 T C 11: 65,927,822 N3230S probably benign Het
Dyrk4 G T 6: 126,916,374 S15* probably null Het
Erc1 T C 6: 119,694,602 R917G probably damaging Het
Fgd2 T A 17: 29,374,108 probably benign Het
Frem3 G T 8: 80,611,191 V38L probably benign Het
Gas2l3 T C 10: 89,413,934 I441V probably benign Het
Gm14393 T A 2: 175,063,981 Y6F probably damaging Het
Gm1527 A G 3: 28,915,268 K256E possibly damaging Het
Gtf2ird1 T A 5: 134,395,802 probably null Het
Hmces C A 6: 87,936,139 T292K probably benign Het
Hpse2 G A 19: 43,388,253 S20L probably benign Het
Ino80 A T 2: 119,379,649 V1387E probably damaging Het
Islr G T 9: 58,157,306 A306D probably damaging Het
Jakmip1 G A 5: 37,100,838 G276D probably damaging Het
Jchain A G 5: 88,526,120 V55A probably benign Het
Kalrn T C 16: 34,187,471 K1350E probably damaging Het
Kansl1l T C 1: 66,801,997 Q48R possibly damaging Het
Kmt5a T C 5: 124,447,271 L23P probably damaging Het
Lrba C T 3: 86,737,142 H381Y probably damaging Het
Lrch3 T C 16: 32,988,495 probably benign Het
Lrrc32 T C 7: 98,499,357 V448A probably benign Het
Mapkbp1 T C 2: 120,017,820 M617T probably damaging Het
Megf6 C T 4: 154,252,419 probably benign Het
Mfap1a T C 2: 121,502,801 M50V probably benign Het
Mgam G T 6: 40,759,128 A854S probably damaging Het
Myh3 A C 11: 67,098,059 probably benign Het
Myo18b C A 5: 112,693,033 R2298L probably damaging Het
Myo1h T A 5: 114,319,704 M92K probably damaging Het
Nfkbib T C 7: 28,762,022 probably null Het
Nlrp2 T A 7: 5,300,951 T192S probably benign Het
Nr2f1 A T 13: 78,198,165 Y137N possibly damaging Het
Nup98 T A 7: 102,147,306 D841V probably damaging Het
Nvl A G 1: 181,139,262 V59A probably damaging Het
Ogdhl C A 14: 32,346,788 N948K probably damaging Het
Olfr530 A G 7: 140,373,113 S166P probably benign Het
Olfr538 A G 7: 140,574,749 T199A probably benign Het
Olfr578 A C 7: 102,984,323 Y280* probably null Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Orc2 A C 1: 58,481,158 probably benign Het
Osgin1 G A 8: 119,444,965 R166H probably damaging Het
Palb2 A T 7: 122,107,523 F741I probably benign Het
Palb2 G T 7: 122,107,524 Y740* probably null Het
Parvb G A 15: 84,271,252 G46D probably damaging Het
Parvb G A 15: 84,271,308 D65N probably benign Het
Pcsk2 A T 2: 143,546,518 K10* probably null Het
Pde3a C T 6: 141,466,206 A502V probably benign Het
Pfas T C 11: 68,991,359 I893V probably benign Het
Pla2g4a A T 1: 149,840,720 D663E probably damaging Het
Prickle2 G A 6: 92,458,602 P6L probably damaging Het
Prx T A 7: 27,517,601 M648K probably benign Het
Ptpn21 T C 12: 98,688,476 N744S probably benign Het
Ptprq C T 10: 107,718,574 V97M probably damaging Het
Pvr T C 7: 19,918,624 E122G possibly damaging Het
Racgap1 T C 15: 99,639,775 K15E probably damaging Het
Rock1 C T 18: 10,136,091 probably null Het
Rorc T A 3: 94,397,302 Y331* probably null Het
Rpl37 T C 15: 5,118,614 V91A probably benign Het
Rrp36 T A 17: 46,672,380 K103* probably null Het
Ryr3 T A 2: 112,653,007 M4142L probably benign Het
Sash1 A T 10: 8,789,593 L125H probably damaging Het
Scn5a T C 9: 119,536,475 M369V possibly damaging Het
Siglec1 A T 2: 131,070,387 N1678K probably benign Het
Slc15a5 A T 6: 138,072,994 V141E probably benign Het
Slc43a1 T C 2: 84,859,676 probably benign Het
Slc8a3 A T 12: 81,199,710 H856Q probably benign Het
Sptlc2 T A 12: 87,355,640 M171L probably benign Het
Srcap T A 7: 127,559,727 probably benign Het
St6gal2 A G 17: 55,490,943 D310G probably damaging Het
Susd2 T A 10: 75,638,054 D689V probably damaging Het
Suz12 A T 11: 80,019,732 E303V possibly damaging Het
Taldo1 C A 7: 141,398,587 T150K probably damaging Het
Tex14 T C 11: 87,549,529 probably benign Het
Tg T A 15: 66,849,463 F274I possibly damaging Het
Tmem151b T C 17: 45,545,737 D259G probably damaging Het
Tmem179 G T 12: 112,501,854 H64Q probably benign Het
Tmem236 A G 2: 14,218,921 T174A probably benign Het
Tmtc1 T A 6: 148,305,985 probably benign Het
Tnc A T 4: 63,966,574 N1821K probably damaging Het
Tnfrsf11a A G 1: 105,825,048 N261S probably damaging Het
Traf6 G T 2: 101,696,649 probably benign Het
Trank1 C A 9: 111,343,232 F96L possibly damaging Het
Trim56 T A 5: 137,113,163 I500F probably damaging Het
Ttc30b G T 2: 75,937,811 S199R probably benign Het
Ttll5 A G 12: 85,879,394 I321V possibly damaging Het
Ttn C A 2: 76,778,023 W17852L probably damaging Het
Twnk G A 19: 45,009,381 V450M probably damaging Het
Uba52 A G 8: 70,509,556 I127T possibly damaging Het
Ubr4 T A 4: 139,421,226 probably null Het
Uggt1 A T 1: 36,176,796 M130K probably benign Het
Ulk4 T A 9: 121,081,656 T1101S probably benign Het
Urb1 A G 16: 90,752,014 S2269P probably benign Het
Ush2a G T 1: 188,400,206 R875L probably benign Het
Usp9y T A Y: 1,332,471 H1624L probably benign Homo
Vipr1 T C 9: 121,665,520 L308S possibly damaging Het
Vps50 G A 6: 3,517,777 probably benign Het
Xdh T G 17: 73,891,112 K1260T probably damaging Het
Yipf4 A G 17: 74,493,968 I94V probably benign Het
Zfhx4 A G 3: 5,413,146 *3582W probably null Het
Zfp58 T C 13: 67,492,025 N116D possibly damaging Het
Zfp750 C A 11: 121,511,993 R643L probably benign Het
Znfx1 A G 2: 167,042,587 V51A possibly damaging Het
Other mutations in Ikbke
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ikbke APN 1 131270012 splice site probably null
IGL00703:Ikbke APN 1 131255302 utr 3 prime probably benign
IGL01079:Ikbke APN 1 131265647 missense possibly damaging 0.64
IGL01106:Ikbke APN 1 131260055 splice site probably benign
IGL01336:Ikbke APN 1 131273756 missense probably damaging 1.00
IGL01505:Ikbke APN 1 131255311 missense probably benign 0.00
IGL01564:Ikbke APN 1 131257921 missense probably benign 0.37
IGL01568:Ikbke APN 1 131257896 splice site probably null
IGL01668:Ikbke APN 1 131256938 missense probably benign 0.05
IGL01977:Ikbke APN 1 131272101 splice site probably benign
IGL02162:Ikbke APN 1 131273715 missense possibly damaging 0.69
IGL02653:Ikbke APN 1 131271835 missense possibly damaging 0.89
IGL02859:Ikbke APN 1 131270197 missense probably damaging 0.97
R0028:Ikbke UTSW 1 131272184 missense possibly damaging 0.87
R0427:Ikbke UTSW 1 131257910 missense possibly damaging 0.62
R0607:Ikbke UTSW 1 131270184 critical splice donor site probably null
R1295:Ikbke UTSW 1 131270226 missense probably benign 0.03
R1470:Ikbke UTSW 1 131276487 missense probably null 1.00
R1720:Ikbke UTSW 1 131259210 missense possibly damaging 0.94
R1728:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1728:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1729:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1729:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1730:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1730:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1739:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1739:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1748:Ikbke UTSW 1 131259200 missense probably benign 0.02
R1762:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1762:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1763:Ikbke UTSW 1 131265877 missense probably benign 0.01
R1783:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1783:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1784:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1784:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1785:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1785:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1794:Ikbke UTSW 1 131259218 missense probably damaging 1.00
R2143:Ikbke UTSW 1 131273474 missense probably damaging 0.98
R2144:Ikbke UTSW 1 131273474 missense probably damaging 0.98
R2145:Ikbke UTSW 1 131273474 missense probably damaging 0.98
R2386:Ikbke UTSW 1 131259266 missense probably damaging 1.00
R2893:Ikbke UTSW 1 131270224 missense probably damaging 1.00
R4210:Ikbke UTSW 1 131263348 missense probably damaging 0.97
R4211:Ikbke UTSW 1 131263348 missense probably damaging 0.97
R4284:Ikbke UTSW 1 131275778 critical splice donor site probably null
R4461:Ikbke UTSW 1 131265922 missense probably benign
R4551:Ikbke UTSW 1 131258033 intron probably benign
R4560:Ikbke UTSW 1 131272120 missense probably damaging 1.00
R4849:Ikbke UTSW 1 131275267 frame shift probably null
R4855:Ikbke UTSW 1 131257111 splice site probably null
R4876:Ikbke UTSW 1 131275267 frame shift probably null
R4879:Ikbke UTSW 1 131275267 frame shift probably null
R4967:Ikbke UTSW 1 131275267 frame shift probably null
R4968:Ikbke UTSW 1 131275267 frame shift probably null
R4971:Ikbke UTSW 1 131275267 frame shift probably null
R5020:Ikbke UTSW 1 131273660 missense probably damaging 1.00
R5699:Ikbke UTSW 1 131276467 critical splice donor site probably null
R5814:Ikbke UTSW 1 131271779 missense probably damaging 0.96
R6392:Ikbke UTSW 1 131275146 splice site probably null
R6492:Ikbke UTSW 1 131259218 missense probably damaging 1.00
R6899:Ikbke UTSW 1 131275762 missense probably damaging 1.00
X0026:Ikbke UTSW 1 131257986 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCTGACAGAGGCACCATTCCAAG -3'
(R):5'- AGAAGTCAGTCCCCAAGGGTAGAAC -3'

Sequencing Primer
(F):5'- GGAATTTTTCCAGCATCCCACAC -3'
(R):5'- acttaaccttcctgagccac -3'
Posted On2014-05-23