Incidental Mutation 'R1725:Usp48'
ID198057
Institutional Source Beutler Lab
Gene Symbol Usp48
Ensembl Gene ENSMUSG00000043411
Gene Nameubiquitin specific peptidase 48
SynonymsUsp31, D330022K21Rik, 2810449C13Rik
MMRRC Submission 039757-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R1725 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location137593755-137658537 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 137633422 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 20 (L20*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055131] [ENSMUST00000105840] [ENSMUST00000141628]
Predicted Effect probably null
Transcript: ENSMUST00000055131
AA Change: L722*
SMART Domains Protein: ENSMUSP00000055016
Gene: ENSMUSG00000043411
AA Change: L722*

DomainStartEndE-ValueType
Pfam:UCH 88 417 6.9e-44 PFAM
Pfam:UCH_1 89 374 1e-22 PFAM
Blast:DUSP 479 555 5e-39 BLAST
coiled coil region 622 643 N/A INTRINSIC
UBQ 954 1022 4.78e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105840
AA Change: L724*
SMART Domains Protein: ENSMUSP00000101466
Gene: ENSMUSG00000043411
AA Change: L724*

DomainStartEndE-ValueType
Pfam:UCH 88 418 6.4e-49 PFAM
Pfam:UCH_1 89 374 1.8e-27 PFAM
Blast:DUSP 480 556 4e-39 BLAST
coiled coil region 624 645 N/A INTRINSIC
Blast:DUSP 743 824 2e-7 BLAST
UBQ 938 1006 4.78e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000128065
AA Change: L141*
SMART Domains Protein: ENSMUSP00000115533
Gene: ENSMUSG00000043411
AA Change: L141*

DomainStartEndE-ValueType
Blast:DUSP 9 111 2e-13 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000131755
Predicted Effect probably null
Transcript: ENSMUST00000141426
AA Change: L20*
SMART Domains Protein: ENSMUSP00000118084
Gene: ENSMUSG00000043411
AA Change: L20*

DomainStartEndE-ValueType
UBQ 63 131 4.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141628
SMART Domains Protein: ENSMUSP00000119691
Gene: ENSMUSG00000043411

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
UBQ 185 253 4.78e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154395
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing domains that associate it with the peptidase family C19, also known as family 2 of ubiquitin carboxyl-terminal hydrolases. Family members function as deubiquitinating enzymes, recognizing and hydrolyzing the peptide bond at the C-terminal glycine of ubiquitin. Enzymes in peptidase family C19 are involved in the processing of poly-ubiquitin precursors as well as that of ubiquitinated proteins. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T G 19: 58,792,762 K10T probably benign Het
2310079G19Rik A T 16: 88,627,275 F109L probably benign Het
Aacs T C 5: 125,482,935 probably null Het
Abcc6 C A 7: 45,992,357 D866Y possibly damaging Het
Acox3 T C 5: 35,592,172 Y214H probably benign Het
Acss2 A G 2: 155,556,844 T404A possibly damaging Het
Adgrb3 T A 1: 25,826,300 E154V probably damaging Het
Akap12 G A 10: 4,353,942 V251M probably damaging Het
Ambp A T 4: 63,144,276 M242K possibly damaging Het
Angptl7 T G 4: 148,500,012 Y93S probably damaging Het
Apof A G 10: 128,269,811 probably benign Het
Arv1 T C 8: 124,728,452 F135L probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cacna1s C T 1: 136,098,623 T1116I probably damaging Het
Ccdc91 A G 6: 147,592,043 E311G unknown Het
Cenpf T C 1: 189,680,479 T196A probably damaging Het
Chd8 A T 14: 52,232,573 S527T probably benign Het
Csmd3 A C 15: 47,596,807 N3529K probably damaging Het
Csnk2a1 T C 2: 152,257,972 V116A probably damaging Het
Dhx36 T G 3: 62,506,939 M1L probably benign Het
Diaph3 A G 14: 86,966,323 probably null Het
Ephb2 G A 4: 136,659,778 Q714* probably null Het
Eprs T A 1: 185,406,992 L858Q probably damaging Het
Espl1 G T 15: 102,313,221 V982L probably benign Het
Eya2 A G 2: 165,724,685 T219A probably benign Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl18 C T 5: 142,886,703 R259H probably damaging Het
Gcc2 G A 10: 58,304,115 R1629H possibly damaging Het
Gje1 G A 10: 14,716,424 R205* probably null Het
Gm10277 TC T 11: 77,786,002 probably null Het
Kmt2d T C 15: 98,845,234 probably benign Het
Krt6a A T 15: 101,692,557 M268K probably damaging Het
Loxhd1 T A 18: 77,293,241 S85T probably benign Het
Loxl3 G A 6: 83,035,593 V38I probably benign Het
Mill2 A G 7: 18,840,068 D26G probably benign Het
Muc15 T C 2: 110,731,246 L9S probably damaging Het
Nat8f4 G A 6: 85,901,098 R148* probably null Het
Nav3 A T 10: 109,823,590 V722E probably damaging Het
Nfkb1 C A 3: 135,667,758 G10W probably damaging Het
Olfr1477 T C 19: 13,502,519 Y59H probably damaging Het
Olfr16 C T 1: 172,957,341 P182L possibly damaging Het
Olfr31 T G 14: 14,328,977 Y289D probably damaging Het
Olfr705 A T 7: 106,714,058 F208I probably benign Het
Pcdhb22 T A 18: 37,520,188 C313S probably benign Het
Plin4 A G 17: 56,106,473 L384P probably damaging Het
Pm20d1 T C 1: 131,816,058 I487T probably damaging Het
Prex1 A T 2: 166,601,736 D334E probably damaging Het
Psg28 A T 7: 18,428,011 I189N possibly damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Rae1 A G 2: 173,006,961 I123M possibly damaging Het
Sh3glb2 C A 2: 30,350,667 E129* probably null Het
Simc1 T C 13: 54,526,406 S856P probably damaging Het
Slc19a1 T A 10: 77,041,838 M69K probably benign Het
Slc30a8 A T 15: 52,333,604 I304F possibly damaging Het
Snx1 A G 9: 66,098,329 probably null Het
Stx18 G A 5: 38,135,255 V234M probably damaging Het
Sulf2 T C 2: 166,081,361 T615A probably damaging Het
Sult3a2 T A 10: 33,779,709 K91N probably benign Het
Tet1 A G 10: 62,814,477 S22P probably damaging Het
Tmc3 T C 7: 83,604,732 V362A probably damaging Het
Trim16 A C 11: 62,820,505 M1L possibly damaging Het
Trp53bp1 C T 2: 121,252,000 V10I possibly damaging Het
Ttc12 T G 9: 49,458,115 D235A probably benign Het
Ttn T C 2: 76,862,383 R452G possibly damaging Het
Ugt2b38 A T 5: 87,411,871 H387Q probably damaging Het
Utrn T C 10: 12,663,519 D1918G probably damaging Het
Vmn1r158 A G 7: 22,790,647 S46P probably benign Het
Vmn2r97 T A 17: 18,929,135 W262R probably benign Het
Vps13d A T 4: 145,143,260 S1917T possibly damaging Het
Vsx1 T C 2: 150,686,200 N158D probably benign Het
Vwf G A 6: 125,646,282 V1781I probably benign Het
Wrap73 T C 4: 154,148,752 Y128H possibly damaging Het
Zfp472 A G 17: 32,977,337 K129E possibly damaging Het
Zscan18 A T 7: 12,770,857 L611Q probably damaging Het
Other mutations in Usp48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Usp48 APN 4 137623272 critical splice acceptor site probably null
IGL01864:Usp48 APN 4 137639227 missense possibly damaging 0.87
IGL02386:Usp48 APN 4 137604523 missense possibly damaging 0.93
IGL03112:Usp48 APN 4 137608064 missense probably damaging 1.00
IGL03114:Usp48 APN 4 137656125 missense probably damaging 1.00
IGL03406:Usp48 APN 4 137639295 missense possibly damaging 0.90
hayao UTSW 4 137633439 nonsense probably null
Mei UTSW 4 137606693 nonsense probably null
miyazaki UTSW 4 137608154 missense probably damaging 1.00
promise UTSW 4 137634921 missense probably damaging 1.00
satsuki UTSW 4 137633126 missense possibly damaging 0.93
totoro UTSW 4 137594483 missense probably damaging 0.99
IGL02796:Usp48 UTSW 4 137610718 missense probably damaging 1.00
R0050:Usp48 UTSW 4 137613803 missense probably damaging 1.00
R0333:Usp48 UTSW 4 137594483 missense probably damaging 0.99
R0382:Usp48 UTSW 4 137621218 missense probably benign 0.00
R0423:Usp48 UTSW 4 137616411 missense probably benign
R0570:Usp48 UTSW 4 137633126 missense possibly damaging 0.93
R0855:Usp48 UTSW 4 137608154 missense probably damaging 1.00
R0943:Usp48 UTSW 4 137644470 missense possibly damaging 0.92
R1367:Usp48 UTSW 4 137639295 missense possibly damaging 0.90
R1367:Usp48 UTSW 4 137644463 missense probably damaging 1.00
R1689:Usp48 UTSW 4 137656107 splice site probably null
R2520:Usp48 UTSW 4 137625251 missense probably benign 0.05
R2965:Usp48 UTSW 4 137613762 missense probably damaging 1.00
R2966:Usp48 UTSW 4 137613762 missense probably damaging 1.00
R3026:Usp48 UTSW 4 137594444 missense probably benign 0.06
R3963:Usp48 UTSW 4 137633439 nonsense probably null
R4087:Usp48 UTSW 4 137623340 missense possibly damaging 0.95
R4633:Usp48 UTSW 4 137634900 missense probably damaging 0.96
R4677:Usp48 UTSW 4 137616381 missense probably benign 0.16
R4735:Usp48 UTSW 4 137633369 nonsense probably null
R4932:Usp48 UTSW 4 137615833 missense probably benign 0.00
R4932:Usp48 UTSW 4 137615834 intron probably null
R4935:Usp48 UTSW 4 137650358 missense probably benign 0.42
R4952:Usp48 UTSW 4 137606693 nonsense probably null
R5034:Usp48 UTSW 4 137606757 nonsense probably null
R5153:Usp48 UTSW 4 137616362 missense possibly damaging 0.68
R5443:Usp48 UTSW 4 137621221 missense possibly damaging 0.78
R5591:Usp48 UTSW 4 137652652 intron probably benign
R5825:Usp48 UTSW 4 137623378 missense probably benign
R5889:Usp48 UTSW 4 137616412 missense probably benign
R5955:Usp48 UTSW 4 137615818 missense probably benign
R6089:Usp48 UTSW 4 137605818 missense probably damaging 1.00
R6443:Usp48 UTSW 4 137613763 missense probably damaging 1.00
R6473:Usp48 UTSW 4 137609108 critical splice donor site probably null
R6482:Usp48 UTSW 4 137634921 missense probably damaging 1.00
R6859:Usp48 UTSW 4 137625276 missense possibly damaging 0.77
R6916:Usp48 UTSW 4 137638233 missense probably damaging 1.00
R6977:Usp48 UTSW 4 137650360 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGTTACAGAGAGTGCTGCTCG -3'
(R):5'- AGAATGTTAGCTTCAAGCCACTCCC -3'

Sequencing Primer
(F):5'- CAAGGTGCGTAGCTCTAATGTC -3'
(R):5'- ccacccacaccacccag -3'
Posted On2014-05-23